Incidental Mutation 'R4972:Prpf19'
ID 384557
Institutional Source Beutler Lab
Gene Symbol Prpf19
Ensembl Gene ENSMUSG00000024735
Gene Name pre-mRNA processing factor 19
Synonyms D19Wsu55e, Snev, Prp19, PSO4
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4972 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 10895231-10909559 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) C to T at 10899345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025642] [ENSMUST00000179297]
AlphaFold Q99KP6
Predicted Effect probably benign
Transcript: ENSMUST00000025642
SMART Domains Protein: ENSMUSP00000025642
Gene: ENSMUSG00000024735

DomainStartEndE-ValueType
Ubox 2 68 3.65e-29 SMART
Pfam:Prp19 94 154 1.5e-25 PFAM
WD40 225 269 4.62e-1 SMART
WD40 272 311 6.32e-11 SMART
WD40 314 353 1.31e-3 SMART
WD40 356 397 2.65e-4 SMART
WD40 400 439 7.79e-11 SMART
WD40 442 482 5.92e1 SMART
WD40 483 522 4.48e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178868
SMART Domains Protein: ENSMUSP00000137435
Gene: ENSMUSG00000024735

DomainStartEndE-ValueType
Pfam:Prp19 1 50 7.9e-23 PFAM
WD40 121 165 4.62e-1 SMART
WD40 168 207 6.32e-11 SMART
WD40 210 249 1.31e-3 SMART
WD40 252 293 2.65e-4 SMART
WD40 296 335 7.79e-11 SMART
WD40 338 378 5.92e1 SMART
WD40 379 418 4.48e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179297
SMART Domains Protein: ENSMUSP00000136858
Gene: ENSMUSG00000024735

DomainStartEndE-ValueType
Ubox 2 68 2.43e-25 SMART
Pfam:Prp19 95 153 1.3e-26 PFAM
WD40 225 269 4.62e-1 SMART
WD40 272 311 6.32e-11 SMART
WD40 314 353 1.31e-3 SMART
WD40 356 397 2.65e-4 SMART
WD40 400 439 7.79e-11 SMART
WD40 442 482 5.92e1 SMART
WD40 483 522 4.48e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191552
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PSO4 is the human homolog of yeast Pso4, a gene essential for cell survival and DNA repair (Beck et al., 2008 [PubMed 18263876]).[supplied by OMIM, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation and have defective cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Prpf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Prpf19 APN 19 10900203 missense probably damaging 0.99
IGL01395:Prpf19 APN 19 10901011 missense probably damaging 0.98
IGL02111:Prpf19 APN 19 10905094 missense probably benign
IGL02163:Prpf19 APN 19 10902436 missense probably benign 0.07
IGL02653:Prpf19 APN 19 10902964 splice site probably benign
bojan UTSW 19 10897790 intron probably benign
R0179:Prpf19 UTSW 19 10897808 splice site probably benign
R1503:Prpf19 UTSW 19 10901022 missense possibly damaging 0.65
R1856:Prpf19 UTSW 19 10902416 missense probably damaging 0.96
R2229:Prpf19 UTSW 19 10897598 missense probably benign 0.02
R4755:Prpf19 UTSW 19 10897790 intron probably benign
R4882:Prpf19 UTSW 19 10898959 intron probably benign
R5110:Prpf19 UTSW 19 10899287 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GGCCCTGCTTTGTAATGTCC -3'
(R):5'- ATCAGAAAGCTCTCGATTGGC -3'

Sequencing Primer
(F):5'- TGTAATGTCCCTTTTCTAACATCATC -3'
(R):5'- AAAGCTCTCGATTGGCAGTGC -3'
Posted On 2016-04-27