Mutagenetix > Incidental Mutation

Incidental Mutation 'R4972:Apba1'

384558

Institutional Source

Beutler Lab

Gene Symbol

Apba1

Ensembl Gene

ENSMUSG00000024897

Gene Name

amyloid beta (A4) precursor protein binding, family A, member 1

Synonyms

6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha

MMRRC Submission

042567-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23758876-23949597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23912536 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 433 (S433T)

Ref Sequence

ENSEMBL: ENSMUSP00000025830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025830]

AlphaFold

B2RUJ5

Predicted Effect

probably benign
Transcript: ENSMUST00000025830
AA Change: S433T

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: S433T

Domain	Start	End	E-Value	Type
low complexity region	40	47	N/A	INTRINSIC
low complexity region	59	74	N/A	INTRINSIC
low complexity region	129	149	N/A	INTRINSIC
low complexity region	404	421	N/A	INTRINSIC
PTB	461	626	9.49e-33	SMART
PDZ	670	748	3.09e-15	SMART
PDZ	762	828	2.53e-11	SMART

Meta Mutation Damage Score

0.0873

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Actn1	T	C	12: 80,173,039	D686G	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Col24a1	A	T	3: 145,509,684	I1444F	probably benign	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Dctn2	C	T	10: 127,276,703	R176C	probably damaging	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Grin3a	T	C	4: 49,770,484	N763D	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Il18r1	C	T	1: 40,491,064	P317L	probably benign	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pde6b	A	G	5: 108,425,264	D500G	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Prph2	G	T	17: 46,910,807	L37F	possibly damaging	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spag16	C	T	1: 70,724,928	R636W	probably damaging	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Trpm7	A	G	2: 126,824,058	V876A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Apba1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01475:Apba1	APN	19	23917586	missense	possibly damaging	0.95
IGL01991:Apba1	APN	19	23937472	missense	possibly damaging	0.80
IGL02048:Apba1	APN	19	23937636	splice site	probably null
IGL02522:Apba1	APN	19	23912445	splice site	probably benign
IGL02728:Apba1	APN	19	23944905	missense	possibly damaging	0.93
IGL02942:Apba1	APN	19	23944971	missense	possibly damaging	0.78
IGL03349:Apba1	APN	19	23917575	missense	probably benign	0.02
IGL03410:Apba1	APN	19	23937581	missense	possibly damaging	0.67
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0084:Apba1	UTSW	19	23912497	missense	possibly damaging	0.68
R0379:Apba1	UTSW	19	23934830	missense	probably damaging	1.00
R0423:Apba1	UTSW	19	23944998	missense	probably damaging	1.00
R1132:Apba1	UTSW	19	23917553	missense	possibly damaging	0.83
R1291:Apba1	UTSW	19	23917672	missense	probably damaging	0.97
R1681:Apba1	UTSW	19	23936561	missense	probably damaging	1.00
R1714:Apba1	UTSW	19	23944952	missense	possibly damaging	0.67
R1756:Apba1	UTSW	19	23893692	missense	possibly damaging	0.83
R1866:Apba1	UTSW	19	23892831	missense	probably benign	0.22
R2076:Apba1	UTSW	19	23893223	nonsense	probably null
R2217:Apba1	UTSW	19	23893962	missense	probably damaging	0.99
R3907:Apba1	UTSW	19	23937506	missense	probably damaging	0.96
R4095:Apba1	UTSW	19	23944024	missense	probably benign	0.00
R4529:Apba1	UTSW	19	23936535	missense	probably damaging	1.00
R4557:Apba1	UTSW	19	23917592	missense	probably damaging	1.00
R5521:Apba1	UTSW	19	23893593	missense	probably damaging	1.00
R6539:Apba1	UTSW	19	23936560	missense	probably damaging	1.00
R7032:Apba1	UTSW	19	23912461	missense	probably benign	0.20
R7035:Apba1	UTSW	19	23917567	missense	possibly damaging	0.88
R7495:Apba1	UTSW	19	23936599	critical splice donor site	probably null
R9149:Apba1	UTSW	19	23893418	missense	probably damaging	1.00
R9288:Apba1	UTSW	19	23945781	makesense	probably null
Z1176:Apba1	UTSW	19	23944115	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTGAAAGCTTGCCTGGC -3'
(R):5'- TTTCACTGACAAACGGCAGG -3'

Sequencing Primer
(F):5'- AAGTCTTCCCCCAACTGCGG -3'
(R):5'- TGACAAACGGCAGGCACAC -3'

Posted On

2016-04-27