Incidental Mutation 'R0347:5830411N06Rik'
ID38456
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene NameRIKEN cDNA 5830411N06 gene
SynonymsScart2
MMRRC Submission 038554-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0347 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140247284-140300736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140297854 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 800 (H800Q)
Ref Sequence ENSEMBL: ENSMUSP00000091520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059882
SMART Domains Protein: ENSMUSP00000061346
Gene: ENSMUSG00000054672

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093984
AA Change: H800Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: H800Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164583
AA Change: H916Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: H916Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211749
Meta Mutation Damage Score 0.4414 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A T 10: 77,984,422 I209F probably damaging Het
Abca4 A G 3: 122,120,099 E908G probably benign Het
Abcb5 T A 12: 118,965,251 probably benign Het
Adhfe1 T A 1: 9,553,430 F102Y probably benign Het
Aff4 A G 11: 53,400,088 Y625C probably benign Het
Alox5 T C 6: 116,413,552 E488G possibly damaging Het
Ankmy2 T C 12: 36,193,754 C323R probably damaging Het
Ankrd28 A G 14: 31,702,022 *1084R probably null Het
Apol10a A T 15: 77,488,691 I176F probably damaging Het
Arhgap26 C T 18: 38,617,744 T70I unknown Het
Arid2 A G 15: 96,370,952 N982S probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camsap3 A G 8: 3,602,029 D291G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdc20b G T 13: 113,059,827 G162V probably damaging Het
Cep44 T G 8: 56,545,475 E56A probably damaging Het
Cfap65 A G 1: 74,926,444 L469P probably damaging Het
Cilp T A 9: 65,280,153 C1177S probably benign Het
Ctnnbip1 C T 4: 149,545,754 P7S probably damaging Het
Cyp11a1 T C 9: 58,016,260 probably benign Het
Cyp3a11 C T 5: 145,865,925 V253M possibly damaging Het
D630045J12Rik C A 6: 38,181,392 V1117L probably damaging Het
Dnah7b T A 1: 46,240,944 S2678T probably damaging Het
Dock1 T C 7: 134,763,867 I428T probably damaging Het
Fam83f A G 15: 80,672,257 D114G probably damaging Het
Flt3 T A 5: 147,357,992 N423I probably damaging Het
Fnbp1l A T 3: 122,590,175 F31L probably damaging Het
Glrx3 G A 7: 137,437,701 E10K unknown Het
Gm12185 T C 11: 48,915,182 E394G probably benign Het
Gm15448 A T 7: 3,822,874 V332E probably damaging Het
Gpatch1 C T 7: 35,297,631 V381M probably benign Het
Grm8 T C 6: 27,981,222 S230G probably benign Het
Heyl A T 4: 123,233,940 D25V probably benign Het
Junb G A 8: 84,978,478 probably benign Het
Klhl29 C A 12: 5,084,354 V747F probably damaging Het
Krt77 T C 15: 101,859,869 H569R unknown Het
Ldhb T C 6: 142,494,133 N227S probably benign Het
Megf6 A G 4: 154,254,635 D543G possibly damaging Het
Mrps23 A T 11: 88,210,693 Q136L probably benign Het
Myh2 C T 11: 67,185,304 probably benign Het
Nadk2 T A 15: 9,084,207 D133E probably benign Het
Neurod4 G A 10: 130,271,111 T98I probably damaging Het
Nfatc2 G T 2: 168,536,290 T465K probably damaging Het
Nipbl A G 15: 8,350,732 S859P probably benign Het
Nipsnap3a T C 4: 52,997,155 probably benign Het
Nlrp4c A G 7: 6,066,416 K439E possibly damaging Het
Olfr1419 A T 19: 11,870,433 L261H probably damaging Het
Olfr392 C T 11: 73,814,311 G257D probably damaging Het
Olfr434 T C 6: 43,217,362 F150L probably benign Het
Pds5b T A 5: 150,736,427 probably benign Het
Plch1 A G 3: 63,753,316 M282T probably damaging Het
Plch2 C A 4: 154,986,721 R1067L possibly damaging Het
Pou2f2 A C 7: 25,097,701 F206V probably damaging Het
Prss50 A G 9: 110,862,350 I49V probably damaging Het
Rexo5 T A 7: 119,823,896 probably null Het
Rgl2 C T 17: 33,932,738 T252I probably damaging Het
Rp1l1 A T 14: 64,030,804 K1280* probably null Het
Rpl24 T A 16: 55,970,177 probably null Het
Satb1 T A 17: 51,739,906 K763* probably null Het
Sema6a T A 18: 47,291,129 R237S probably damaging Het
Spg11 T C 2: 122,097,369 T645A probably damaging Het
Srrt T A 5: 137,299,676 probably benign Het
Tanc1 T C 2: 59,842,991 V1480A probably benign Het
Tbc1d2 T C 4: 46,620,574 D412G possibly damaging Het
Tecrl T C 5: 83,294,632 E198G probably damaging Het
Tigd4 A G 3: 84,593,860 D28G probably damaging Het
Trp53bp2 T G 1: 182,441,648 L226V probably benign Het
Ttll13 T C 7: 80,260,505 S799P possibly damaging Het
Vps13c A T 9: 67,910,233 Q1062H possibly damaging Het
Wnt10a T G 1: 74,793,543 H98Q probably damaging Het
Zfp651 C T 9: 121,763,102 P198S probably damaging Het
Zfp959 T A 17: 55,897,180 Y69* probably null Het
Znrd1as T A 17: 36,965,315 M114K probably damaging Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGATTGCCAACTGCTCATCAAC -3'
(R):5'- GGCCGAAAATATCAACCTGGCATCC -3'

Sequencing Primer
(F):5'- ACTCTTAGCTGCCCAGGTAAC -3'
(R):5'- GTGGGAGCAGTCTCCATATC -3'
Posted On2013-05-23