Incidental Mutation 'R4545:Akr1c20'
ID384565
Institutional Source Beutler Lab
Gene Symbol Akr1c20
Ensembl Gene ENSMUSG00000054757
Gene Namealdo-keto reductase family 1, member C20
Synonyms2610528B18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location4486849-4523345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 4507844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 201 (V201G)
Ref Sequence ENSEMBL: ENSMUSP00000077363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078239] [ENSMUST00000080361]
Predicted Effect probably damaging
Transcript: ENSMUST00000078239
AA Change: V201G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077363
Gene: ENSMUSG00000054757
AA Change: V201G

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 98 4.7e-12 PFAM
Pfam:Aldo_ket_red 87 260 6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080361
AA Change: V228G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079232
Gene: ENSMUSG00000054757
AA Change: V228G

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.8e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221564
AA Change: V200G
Meta Mutation Damage Score 0.5944 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Akr1c20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Akr1c20 APN 13 4512665 critical splice donor site probably null
IGL01799:Akr1c20 APN 13 4514258 splice site probably null
IGL01930:Akr1c20 APN 13 4507648 intron probably benign
IGL02277:Akr1c20 APN 13 4514405 missense probably benign 0.01
IGL02811:Akr1c20 APN 13 4512683 missense possibly damaging 0.86
IGL03349:Akr1c20 APN 13 4508250 nonsense probably null
R0165:Akr1c20 UTSW 13 4523296 missense probably benign 0.02
R0193:Akr1c20 UTSW 13 4511293 splice site probably benign
R0440:Akr1c20 UTSW 13 4487208 missense probably benign 0.01
R1248:Akr1c20 UTSW 13 4514400 missense possibly damaging 0.52
R1396:Akr1c20 UTSW 13 4507727 missense probably damaging 1.00
R1735:Akr1c20 UTSW 13 4487208 missense probably benign 0.00
R2325:Akr1c20 UTSW 13 4523296 missense probably benign 0.02
R2359:Akr1c20 UTSW 13 4523277 missense probably damaging 0.96
R2878:Akr1c20 UTSW 13 4507775 missense probably damaging 1.00
R3712:Akr1c20 UTSW 13 4510223 missense probably damaging 1.00
R4512:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4514:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4544:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4781:Akr1c20 UTSW 13 4508175 nonsense probably null
R5301:Akr1c20 UTSW 13 4523280 missense probably damaging 1.00
R5826:Akr1c20 UTSW 13 4510223 missense probably damaging 1.00
R7122:Akr1c20 UTSW 13 4511276 missense probably benign 0.01
R7661:Akr1c20 UTSW 13 4508219 missense probably benign 0.00
R7832:Akr1c20 UTSW 13 4512672 missense probably damaging 1.00
Z1177:Akr1c20 UTSW 13 4523244 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGACTATCAACAATGTATTTCGGGC -3'
(R):5'- TCCATGTACTGAAAATCCTGGC -3'

Sequencing Primer
(F):5'- CTGTGTAGGTGCCTAATACCCAAAG -3'
(R):5'- AATCCTGGCATATATATCAACCTTCC -3'
Posted On2016-04-29