Incidental Mutation 'R4597:Supt16'
ID 384576
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission 041813-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R4597 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 52173589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 686 (G686D)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: G686D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: G686D

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.9723 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4931422A03Rik T A 2: 104,026,155 probably benign Het
Adh5 T C 3: 138,445,357 V27A probably damaging Het
Ank2 A T 3: 126,988,151 D843E probably damaging Het
Arid2 A G 15: 96,370,856 N950S probably damaging Het
Arl1 A T 10: 88,730,746 probably benign Het
Bcl3 T G 7: 19,812,503 I136L probably damaging Het
C130060K24Rik T C 6: 65,447,424 probably null Het
Car9 T A 4: 43,509,138 S235R probably damaging Het
Carnmt1 G T 19: 18,671,087 G30W probably damaging Het
Casp12 C T 9: 5,348,941 T101I possibly damaging Het
Cdh23 A G 10: 60,409,044 L1026P probably damaging Het
Clec10a A T 11: 70,169,980 Y186F probably damaging Het
Col22a1 G T 15: 71,964,662 A508E possibly damaging Het
Crocc G C 4: 141,019,777 S1573R probably damaging Het
Cttnbp2nl G T 3: 105,005,875 T231K possibly damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Ehbp1l1 T C 19: 5,717,927 E1116G possibly damaging Het
Fam83d T C 2: 158,785,222 V277A possibly damaging Het
Fga G T 3: 83,031,235 G306* probably null Het
Fkbp9 A G 6: 56,832,382 Y59C probably damaging Het
Frmpd1 A G 4: 45,274,441 T450A probably benign Het
Gabbr1 A G 17: 37,056,899 M414V possibly damaging Het
Gm15448 T A 7: 3,822,155 Y496F possibly damaging Het
Gm16506 A G 14: 43,725,115 F112L unknown Het
Gm27047 T C 6: 130,630,336 noncoding transcript Het
Gm4353 T A 7: 116,083,612 K245* probably null Het
Gm4950 A T 18: 51,865,793 I30N probably benign Het
Gm8298 T A 3: 59,876,793 M229K possibly damaging Het
H2-M10.2 T C 17: 36,285,393 T187A probably benign Het
H60c A T 10: 3,259,968 N106K possibly damaging Het
Hist1h1b A T 13: 21,780,511 V15E probably damaging Het
Hoxa6 T C 6: 52,208,407 probably null Het
Ighv1-74 A G 12: 115,802,656 C115R probably damaging Het
Il17a G A 1: 20,730,993 probably null Het
Itga9 T C 9: 118,843,514 Y199H probably damaging Het
Itpr3 C T 17: 27,093,283 R554C probably damaging Het
Kcnc3 T A 7: 44,595,816 M510K probably damaging Het
Kif15 A G 9: 122,993,849 T432A probably benign Het
Kif26b A T 1: 178,916,793 S1485C probably damaging Het
Klhl2 C A 8: 64,754,387 G313W probably damaging Het
Klhl32 C T 4: 24,629,339 S476N probably benign Het
Krt1 C T 15: 101,847,628 E386K possibly damaging Het
Lats1 T C 10: 7,691,746 S94P probably benign Het
Ltf G A 9: 111,022,933 C146Y probably damaging Het
Mars A G 10: 127,300,453 L501P probably damaging Het
Myh2 A C 11: 67,189,418 I1153L probably benign Het
Ncstn A T 1: 172,068,256 Y522* probably null Het
Nipal4 A G 11: 46,151,329 V175A probably damaging Het
Olfr860 T C 9: 19,845,691 I309M probably benign Het
Pcdha1 C G 18: 36,931,906 A541G possibly damaging Het
Pex11g A G 8: 3,464,043 Y40H probably damaging Het
Rin2 G T 2: 145,860,905 R507L probably benign Het
Sh2b2 T C 5: 136,231,762 D200G probably damaging Het
Smg7 C A 1: 152,840,301 probably null Het
Snx17 T C 5: 31,198,513 probably benign Het
Sos1 T C 17: 80,433,826 Y510C probably benign Het
Spata31d1c T A 13: 65,035,613 L323* probably null Het
Szt2 C T 4: 118,372,681 R2751H unknown Het
Tnfsf8 A G 4: 63,837,100 L95P probably damaging Het
Vmn2r17 A G 5: 109,429,562 H493R probably benign Het
Zfp770 C T 2: 114,196,770 A273T possibly damaging Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- TGCAACTGTAATCAAAGTCACTAGC -3'
(R):5'- TGTGCTGGACTGTAGCTTCC -3'

Sequencing Primer
(F):5'- CTGTAATCAAAGTCACTAGCCTACTG -3'
(R):5'- CTGTAGCTTCCCAGAGTAGAACATG -3'
Posted On 2016-05-10