Incidental Mutation 'R4978:Amer3'
ID384580
Institutional Source Beutler Lab
Gene Symbol Amer3
Ensembl Gene ENSMUSG00000045174
Gene NameAPC membrane recruitment 3
SynonymsFam123c, 9430069J07Rik
MMRRC Submission 042573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4978 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location34579657-34590944 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 34579300 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000054748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052670]
Predicted Effect probably benign
Transcript: ENSMUST00000052670
SMART Domains Protein: ENSMUSP00000054748
Gene: ENSMUSG00000045174

DomainStartEndE-ValueType
Pfam:WTX 138 444 1.6e-37 PFAM
low complexity region 506 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062557
SMART Domains Protein: ENSMUSP00000062559
Gene: ENSMUSG00000045815

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186712
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,401 P673S probably damaging Het
Adam39 T C 8: 40,825,337 I255T possibly damaging Het
Adgrg6 A G 10: 14,420,461 F1093S probably damaging Het
Avil A T 10: 127,018,396 N744I probably benign Het
B430305J03Rik T C 3: 61,364,019 probably benign Het
Caps2 A T 10: 112,182,494 Q141L probably benign Het
Capza2 T A 6: 17,662,115 D201E probably null Het
Ccdc7b T C 8: 129,110,207 probably null Het
Clcn6 C T 4: 148,008,770 V818I probably benign Het
Cpeb4 C T 11: 31,931,509 H723Y probably null Het
Cspp1 T A 1: 10,083,517 F384I possibly damaging Het
Cyp2c50 T G 19: 40,098,057 V355G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpys A T 15: 39,826,936 D340E possibly damaging Het
Dsp T A 13: 38,182,234 L548Q probably damaging Het
Dyrk2 A T 10: 118,860,347 D335E probably benign Het
Etaa1 T C 11: 17,946,581 D512G probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fh1 A T 1: 175,603,967 M451K probably damaging Het
Flrt1 A G 19: 7,096,876 L102P probably damaging Het
Gins2 A G 8: 120,588,811 L40S possibly damaging Het
Gm5436 G A 12: 84,258,687 noncoding transcript Het
Gm7298 T G 6: 121,733,117 probably null Het
Gm7353 A G 7: 3,110,038 noncoding transcript Het
Gramd1a T C 7: 31,132,788 E608G possibly damaging Het
Hcls1 T C 16: 36,937,860 W38R probably damaging Het
Ik C T 18: 36,747,415 P51S possibly damaging Het
Irx1 A G 13: 71,963,485 S2P possibly damaging Het
Kng2 T A 16: 22,987,916 N511I probably damaging Het
Limk2 G T 11: 3,409,069 probably benign Het
Map1a T G 2: 121,301,142 V813G probably benign Het
Mast1 T C 8: 84,935,787 T31A probably damaging Het
N4bp2 T C 5: 65,790,240 F71S probably damaging Het
Neurod1 C T 2: 79,454,227 G271R probably damaging Het
Olfr686 T C 7: 105,204,191 I51V probably benign Het
Pcdhb22 A G 18: 37,518,601 T41A probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Pde9a T A 17: 31,473,223 D497E probably benign Het
Plaa A G 4: 94,589,932 S98P possibly damaging Het
Prl2c1 A G 13: 27,857,570 T192A probably benign Het
Ptpn18 T C 1: 34,469,813 probably benign Het
Rab27b C T 18: 69,994,514 V68I probably benign Het
Reep5 A G 18: 34,373,296 F9S probably damaging Het
Scaf11 T C 15: 96,415,917 N1328D probably damaging Het
Slc25a13 G A 6: 6,042,300 S626F probably damaging Het
Smg1 A G 7: 118,154,247 probably benign Het
Spock2 T A 10: 60,131,089 F332I probably benign Het
Tep1 C T 14: 50,845,434 R1039Q possibly damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Tradd T C 8: 105,259,268 Q217R probably benign Het
Umodl1 T C 17: 30,986,081 I550T probably benign Het
Vgll3 T A 16: 65,815,686 Y18* probably null Het
Vmn1r49 G T 6: 90,072,890 N43K probably benign Het
Vps50 A G 6: 3,517,808 N82S probably benign Het
Vstm2a A G 11: 16,261,460 D90G possibly damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wrnip1 A G 13: 32,816,312 D434G probably damaging Het
Zan C T 5: 137,406,921 probably benign Het
Zfp286 A G 11: 62,788,928 probably null Het
Zkscan17 A G 11: 59,493,227 V123A possibly damaging Het
Zkscan2 C G 7: 123,495,319 A211P possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Amer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Amer3 APN 1 34588527 missense probably benign 0.26
IGL01062:Amer3 APN 1 34586739 missense probably damaging 0.96
IGL01501:Amer3 APN 1 34588317 missense probably benign
IGL02642:Amer3 APN 1 34586680 utr 5 prime probably benign
IGL02861:Amer3 APN 1 34588125 missense probably damaging 1.00
IGL02953:Amer3 APN 1 34587796 missense probably damaging 0.98
R0183:Amer3 UTSW 1 34587757 missense probably damaging 0.99
R0335:Amer3 UTSW 1 34579300 unclassified probably benign
R0639:Amer3 UTSW 1 34587821 nonsense probably null
R1391:Amer3 UTSW 1 34588389 missense probably benign 0.09
R1514:Amer3 UTSW 1 34579327 unclassified probably benign
R1615:Amer3 UTSW 1 34588171 missense probably damaging 0.99
R2014:Amer3 UTSW 1 34579444 unclassified probably benign
R2104:Amer3 UTSW 1 34588678 missense probably benign 0.00
R3080:Amer3 UTSW 1 34588422 missense probably benign 0.23
R4508:Amer3 UTSW 1 34588299 missense probably benign 0.00
R4635:Amer3 UTSW 1 34587877 missense probably damaging 1.00
R4990:Amer3 UTSW 1 34588741 missense probably benign 0.17
R4991:Amer3 UTSW 1 34588741 missense probably benign 0.17
R5112:Amer3 UTSW 1 34587076 missense possibly damaging 0.94
R5645:Amer3 UTSW 1 34588381 missense possibly damaging 0.76
R6483:Amer3 UTSW 1 34587690 missense probably damaging 0.97
R6769:Amer3 UTSW 1 34588249 missense possibly damaging 0.93
R7097:Amer3 UTSW 1 34588788 missense probably benign
R7246:Amer3 UTSW 1 34586728 missense possibly damaging 0.82
R7347:Amer3 UTSW 1 34587902 missense probably damaging 1.00
R7466:Amer3 UTSW 1 34587993 missense probably damaging 1.00
R7719:Amer3 UTSW 1 34589002 missense possibly damaging 0.55
R8158:Amer3 UTSW 1 34587660 missense possibly damaging 0.68
RF016:Amer3 UTSW 1 34587120 missense probably damaging 1.00
X0020:Amer3 UTSW 1 34588836 missense probably benign 0.00
Z1176:Amer3 UTSW 1 34589013 missense probably benign
Z1177:Amer3 UTSW 1 34587196 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGCTAGCGGAGTTTCTTTACC -3'
(R):5'- GCTGCTCCCATAATGCTGTG -3'

Sequencing Primer
(F):5'- TCCTCAGTTCTGCGGGAG -3'
(R):5'- GTGGGTTTTGCATCCCTAAAC -3'
Posted On2016-05-10