Incidental Mutation 'R4978:Gramd1a'
ID384598
Institutional Source Beutler Lab
Gene Symbol Gramd1a
Ensembl Gene ENSMUSG00000001248
Gene NameGRAM domain containing 1A
SynonymsD7Bwg0611e, 1300003M23Rik
MMRRC Submission 042573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R4978 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location31130127-31155896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31132788 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 608 (E608G)
Ref Sequence ENSEMBL: ENSMUSP00000082778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001280] [ENSMUST00000085636] [ENSMUST00000186634]
Predicted Effect probably benign
Transcript: ENSMUST00000001280
AA Change: E642G

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001280
Gene: ENSMUSG00000001248
AA Change: E642G

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 520 7.3e-37 PFAM
low complexity region 531 542 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
transmembrane domain 606 628 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085636
AA Change: E608G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082778
Gene: ENSMUSG00000001248
AA Change: E608G

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 500 1.1e-28 PFAM
low complexity region 514 528 N/A INTRINSIC
transmembrane domain 572 594 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185985
Predicted Effect probably benign
Transcript: ENSMUST00000186634
SMART Domains Protein: ENSMUSP00000140195
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 8.9e-32 SMART
low complexity region 342 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188032
Predicted Effect unknown
Transcript: ENSMUST00000202814
AA Change: E204G
Predicted Effect probably benign
Transcript: ENSMUST00000206233
Predicted Effect probably benign
Transcript: ENSMUST00000206432
Predicted Effect unknown
Transcript: ENSMUST00000220635
AA Change: E96G
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,401 P673S probably damaging Het
Adam39 T C 8: 40,825,337 I255T possibly damaging Het
Adgrg6 A G 10: 14,420,461 F1093S probably damaging Het
Amer3 A G 1: 34,579,300 probably benign Het
Avil A T 10: 127,018,396 N744I probably benign Het
B430305J03Rik T C 3: 61,364,019 probably benign Het
Caps2 A T 10: 112,182,494 Q141L probably benign Het
Capza2 T A 6: 17,662,115 D201E probably null Het
Ccdc7b T C 8: 129,110,207 probably null Het
Clcn6 C T 4: 148,008,770 V818I probably benign Het
Cpeb4 C T 11: 31,931,509 H723Y probably null Het
Cspp1 T A 1: 10,083,517 F384I possibly damaging Het
Cyp2c50 T G 19: 40,098,057 V355G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpys A T 15: 39,826,936 D340E possibly damaging Het
Dsp T A 13: 38,182,234 L548Q probably damaging Het
Dyrk2 A T 10: 118,860,347 D335E probably benign Het
Etaa1 T C 11: 17,946,581 D512G probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fh1 A T 1: 175,603,967 M451K probably damaging Het
Flrt1 A G 19: 7,096,876 L102P probably damaging Het
Gins2 A G 8: 120,588,811 L40S possibly damaging Het
Gm5436 G A 12: 84,258,687 noncoding transcript Het
Gm7298 T G 6: 121,733,117 probably null Het
Gm7353 A G 7: 3,110,038 noncoding transcript Het
Hcls1 T C 16: 36,937,860 W38R probably damaging Het
Ik C T 18: 36,747,415 P51S possibly damaging Het
Irx1 A G 13: 71,963,485 S2P possibly damaging Het
Kng2 T A 16: 22,987,916 N511I probably damaging Het
Limk2 G T 11: 3,409,069 probably benign Het
Map1a T G 2: 121,301,142 V813G probably benign Het
Mast1 T C 8: 84,935,787 T31A probably damaging Het
N4bp2 T C 5: 65,790,240 F71S probably damaging Het
Neurod1 C T 2: 79,454,227 G271R probably damaging Het
Olfr686 T C 7: 105,204,191 I51V probably benign Het
Pcdhb22 A G 18: 37,518,601 T41A probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Pde9a T A 17: 31,473,223 D497E probably benign Het
Plaa A G 4: 94,589,932 S98P possibly damaging Het
Prl2c1 A G 13: 27,857,570 T192A probably benign Het
Ptpn18 T C 1: 34,469,813 probably benign Het
Rab27b C T 18: 69,994,514 V68I probably benign Het
Reep5 A G 18: 34,373,296 F9S probably damaging Het
Scaf11 T C 15: 96,415,917 N1328D probably damaging Het
Slc25a13 G A 6: 6,042,300 S626F probably damaging Het
Smg1 A G 7: 118,154,247 probably benign Het
Spock2 T A 10: 60,131,089 F332I probably benign Het
Tep1 C T 14: 50,845,434 R1039Q possibly damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Tradd T C 8: 105,259,268 Q217R probably benign Het
Umodl1 T C 17: 30,986,081 I550T probably benign Het
Vgll3 T A 16: 65,815,686 Y18* probably null Het
Vmn1r49 G T 6: 90,072,890 N43K probably benign Het
Vps50 A G 6: 3,517,808 N82S probably benign Het
Vstm2a A G 11: 16,261,460 D90G possibly damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wrnip1 A G 13: 32,816,312 D434G probably damaging Het
Zan C T 5: 137,406,921 probably benign Het
Zfp286 A G 11: 62,788,928 probably null Het
Zkscan17 A G 11: 59,493,227 V123A possibly damaging Het
Zkscan2 C G 7: 123,495,319 A211P possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Gramd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Gramd1a APN 7 31142568 missense probably damaging 0.99
IGL01627:Gramd1a APN 7 31139796 missense probably damaging 0.99
IGL01684:Gramd1a APN 7 31138905 missense possibly damaging 0.67
IGL01793:Gramd1a APN 7 31134413 critical splice donor site probably null
IGL01986:Gramd1a APN 7 31134009 missense possibly damaging 0.58
IGL02029:Gramd1a APN 7 31132824 missense possibly damaging 0.95
IGL02060:Gramd1a APN 7 31130571 nonsense probably null
IGL02569:Gramd1a APN 7 31130507 unclassified probably benign
IGL02606:Gramd1a APN 7 31134515 missense probably damaging 1.00
IGL02715:Gramd1a APN 7 31135854 missense probably damaging 1.00
IGL03253:Gramd1a APN 7 31139846 nonsense probably null
PIT4377001:Gramd1a UTSW 7 31143670 missense possibly damaging 0.95
PIT4618001:Gramd1a UTSW 7 31132596 missense probably benign 0.00
R0179:Gramd1a UTSW 7 31142418 missense probably damaging 1.00
R0329:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0330:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0628:Gramd1a UTSW 7 31142624 missense probably damaging 1.00
R0834:Gramd1a UTSW 7 31138164 missense possibly damaging 0.94
R1421:Gramd1a UTSW 7 31142866 missense probably damaging 0.98
R1430:Gramd1a UTSW 7 31132786 missense probably damaging 0.97
R1682:Gramd1a UTSW 7 31142900 splice site probably null
R1703:Gramd1a UTSW 7 31139534 missense possibly damaging 0.96
R1822:Gramd1a UTSW 7 31142573 missense probably damaging 1.00
R2308:Gramd1a UTSW 7 31139790 missense probably damaging 0.97
R3861:Gramd1a UTSW 7 31135940 missense possibly damaging 0.90
R4184:Gramd1a UTSW 7 31132515 intron probably benign
R4908:Gramd1a UTSW 7 31138867 missense probably benign 0.27
R5723:Gramd1a UTSW 7 31134483 missense probably damaging 1.00
R5927:Gramd1a UTSW 7 31139821 missense probably benign 0.33
R6466:Gramd1a UTSW 7 31143796 missense probably benign
R6838:Gramd1a UTSW 7 31134504 missense probably benign 0.30
R7034:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7036:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7867:Gramd1a UTSW 7 31143567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTGCAGAGCCAAGATCTC -3'
(R):5'- ATGGCCAGCAAGCATGTAGG -3'

Sequencing Primer
(F):5'- GAGCCAAGATCTCCGCCC -3'
(R):5'- GCTGTGTGACCCTAGGCATATC -3'
Posted On2016-05-10