Incidental Mutation 'R4978:Wrnip1'
ID384624
Institutional Source Beutler Lab
Gene Symbol Wrnip1
Ensembl Gene ENSMUSG00000021400
Gene NameWerner helicase interacting protein 1
Synonyms4833444L21Rik, WHIP
MMRRC Submission 042573-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4978 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location32802038-32822609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32816312 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 434 (D434G)
Ref Sequence ENSEMBL: ENSMUSP00000021832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021832]
Predicted Effect probably damaging
Transcript: ENSMUST00000021832
AA Change: D434G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021832
Gene: ENSMUSG00000021400
AA Change: D434G

DomainStartEndE-ValueType
ZnF_Rad18 17 40 4.76e-10 SMART
low complexity region 90 110 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 158 183 N/A INTRINSIC
AAA 255 375 9.86e-16 SMART
Pfam:AAA_assoc_2 413 506 6.4e-26 PFAM
Pfam:MgsA_C 507 659 3.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221066
Predicted Effect probably benign
Transcript: ENSMUST00000229351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230949
Meta Mutation Damage Score 0.9581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Werner's syndrome is a rare autosomal recessive disorder characterized by accelerated aging that is caused by defects in the Werner syndrome ATP-dependent helicase gene (WRN). The protein encoded by this gene interacts with the exonuclease-containing N-terminal portion of the Werner protein. This protein has a ubiquitin-binding zinc-finger domain in the N-terminus, an ATPase domain, and two leucine zipper motifs in the C-terminus. It has sequence similarity to replication factor C family proteins and is conserved from E. coli to human. This protein likely accumulates at sites of DNA damage by interacting with polyubiquinated proteins and also binds to DNA polymerase delta and increases the initiation frequency of DNA polymerase delta-mediated DNA synthesis. This protein also interacts with nucleoporins at nuclear pore complexes. Two transcript variants encoding different isoforms have been isolated for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,401 P673S probably damaging Het
Adam39 T C 8: 40,825,337 I255T possibly damaging Het
Adgrg6 A G 10: 14,420,461 F1093S probably damaging Het
Amer3 A G 1: 34,579,300 probably benign Het
Avil A T 10: 127,018,396 N744I probably benign Het
B430305J03Rik T C 3: 61,364,019 probably benign Het
Caps2 A T 10: 112,182,494 Q141L probably benign Het
Capza2 T A 6: 17,662,115 D201E probably null Het
Ccdc7b T C 8: 129,110,207 probably null Het
Clcn6 C T 4: 148,008,770 V818I probably benign Het
Cpeb4 C T 11: 31,931,509 H723Y probably null Het
Cspp1 T A 1: 10,083,517 F384I possibly damaging Het
Cyp2c50 T G 19: 40,098,057 V355G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpys A T 15: 39,826,936 D340E possibly damaging Het
Dsp T A 13: 38,182,234 L548Q probably damaging Het
Dyrk2 A T 10: 118,860,347 D335E probably benign Het
Etaa1 T C 11: 17,946,581 D512G probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fh1 A T 1: 175,603,967 M451K probably damaging Het
Flrt1 A G 19: 7,096,876 L102P probably damaging Het
Gins2 A G 8: 120,588,811 L40S possibly damaging Het
Gm5436 G A 12: 84,258,687 noncoding transcript Het
Gm7298 T G 6: 121,733,117 probably null Het
Gm7353 A G 7: 3,110,038 noncoding transcript Het
Gramd1a T C 7: 31,132,788 E608G possibly damaging Het
Hcls1 T C 16: 36,937,860 W38R probably damaging Het
Ik C T 18: 36,747,415 P51S possibly damaging Het
Irx1 A G 13: 71,963,485 S2P possibly damaging Het
Kng2 T A 16: 22,987,916 N511I probably damaging Het
Limk2 G T 11: 3,409,069 probably benign Het
Map1a T G 2: 121,301,142 V813G probably benign Het
Mast1 T C 8: 84,935,787 T31A probably damaging Het
N4bp2 T C 5: 65,790,240 F71S probably damaging Het
Neurod1 C T 2: 79,454,227 G271R probably damaging Het
Olfr686 T C 7: 105,204,191 I51V probably benign Het
Pcdhb22 A G 18: 37,518,601 T41A probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Pde9a T A 17: 31,473,223 D497E probably benign Het
Plaa A G 4: 94,589,932 S98P possibly damaging Het
Prl2c1 A G 13: 27,857,570 T192A probably benign Het
Ptpn18 T C 1: 34,469,813 probably benign Het
Rab27b C T 18: 69,994,514 V68I probably benign Het
Reep5 A G 18: 34,373,296 F9S probably damaging Het
Scaf11 T C 15: 96,415,917 N1328D probably damaging Het
Slc25a13 G A 6: 6,042,300 S626F probably damaging Het
Smg1 A G 7: 118,154,247 probably benign Het
Spock2 T A 10: 60,131,089 F332I probably benign Het
Tep1 C T 14: 50,845,434 R1039Q possibly damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Tradd T C 8: 105,259,268 Q217R probably benign Het
Umodl1 T C 17: 30,986,081 I550T probably benign Het
Vgll3 T A 16: 65,815,686 Y18* probably null Het
Vmn1r49 G T 6: 90,072,890 N43K probably benign Het
Vps50 A G 6: 3,517,808 N82S probably benign Het
Vstm2a A G 11: 16,261,460 D90G possibly damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Zan C T 5: 137,406,921 probably benign Het
Zfp286 A G 11: 62,788,928 probably null Het
Zkscan17 A G 11: 59,493,227 V123A possibly damaging Het
Zkscan2 C G 7: 123,495,319 A211P possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Wrnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Wrnip1 APN 13 32816329 missense probably damaging 1.00
IGL02608:Wrnip1 APN 13 32806874 missense probably damaging 1.00
IGL02947:Wrnip1 APN 13 32822070 missense probably damaging 1.00
R0028:Wrnip1 UTSW 13 32820297 missense probably damaging 1.00
R0131:Wrnip1 UTSW 13 32806864 missense probably damaging 0.98
R0212:Wrnip1 UTSW 13 32821906 missense probably benign 0.45
R0545:Wrnip1 UTSW 13 32806813 missense probably damaging 1.00
R0638:Wrnip1 UTSW 13 32821090 missense possibly damaging 0.82
R1650:Wrnip1 UTSW 13 32805379 missense probably benign 0.02
R1894:Wrnip1 UTSW 13 32805336 critical splice acceptor site probably null
R2176:Wrnip1 UTSW 13 32820240 missense probably damaging 1.00
R2371:Wrnip1 UTSW 13 32802427 missense probably benign
R2475:Wrnip1 UTSW 13 32806958 missense probably benign 0.30
R3122:Wrnip1 UTSW 13 32802761 missense probably benign 0.06
R4247:Wrnip1 UTSW 13 32806883 missense probably damaging 1.00
R4604:Wrnip1 UTSW 13 32802347 missense probably damaging 1.00
R5109:Wrnip1 UTSW 13 32816336 missense probably damaging 1.00
R5148:Wrnip1 UTSW 13 32806856 missense probably damaging 1.00
R5929:Wrnip1 UTSW 13 32806966 missense probably damaging 1.00
R6750:Wrnip1 UTSW 13 32802756 missense probably damaging 0.99
R7137:Wrnip1 UTSW 13 32802749 missense probably benign 0.01
R7142:Wrnip1 UTSW 13 32802633 missense possibly damaging 0.51
R7378:Wrnip1 UTSW 13 32816281 missense probably benign 0.33
R7468:Wrnip1 UTSW 13 32816377 missense possibly damaging 0.80
R7470:Wrnip1 UTSW 13 32816327 nonsense probably null
R8049:Wrnip1 UTSW 13 32821977 missense probably benign
R8260:Wrnip1 UTSW 13 32805356 missense possibly damaging 0.80
X0019:Wrnip1 UTSW 13 32806766 missense probably damaging 1.00
X0027:Wrnip1 UTSW 13 32802724 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCTTAGGACTTAGGAAACTTGG -3'
(R):5'- GCACGGTCATATAAAATGTGGG -3'

Sequencing Primer
(F):5'- AGGACTTAGGAAACTTGGTCAGTTC -3'
(R):5'- TCATATAAAATGTGGGACCGCTG -3'
Posted On2016-05-10