Incidental Mutation 'R4978:Umodl1'
ID384632
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
MMRRC Submission 042573-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4978 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30986081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 550 (I550T)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
Predicted Effect probably benign
Transcript: ENSMUST00000066554
AA Change: I550T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: I550T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066981
AA Change: I550T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: I550T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114555
AA Change: I550T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: I550T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,401 P673S probably damaging Het
Adam39 T C 8: 40,825,337 I255T possibly damaging Het
Adgrg6 A G 10: 14,420,461 F1093S probably damaging Het
Amer3 A G 1: 34,579,300 probably benign Het
Avil A T 10: 127,018,396 N744I probably benign Het
B430305J03Rik T C 3: 61,364,019 probably benign Het
Caps2 A T 10: 112,182,494 Q141L probably benign Het
Capza2 T A 6: 17,662,115 D201E probably null Het
Ccdc7b T C 8: 129,110,207 probably null Het
Clcn6 C T 4: 148,008,770 V818I probably benign Het
Cpeb4 C T 11: 31,931,509 H723Y probably null Het
Cspp1 T A 1: 10,083,517 F384I possibly damaging Het
Cyp2c50 T G 19: 40,098,057 V355G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpys A T 15: 39,826,936 D340E possibly damaging Het
Dsp T A 13: 38,182,234 L548Q probably damaging Het
Dyrk2 A T 10: 118,860,347 D335E probably benign Het
Etaa1 T C 11: 17,946,581 D512G probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fh1 A T 1: 175,603,967 M451K probably damaging Het
Flrt1 A G 19: 7,096,876 L102P probably damaging Het
Gins2 A G 8: 120,588,811 L40S possibly damaging Het
Gm5436 G A 12: 84,258,687 noncoding transcript Het
Gm7298 T G 6: 121,733,117 probably null Het
Gm7353 A G 7: 3,110,038 noncoding transcript Het
Gramd1a T C 7: 31,132,788 E608G possibly damaging Het
Hcls1 T C 16: 36,937,860 W38R probably damaging Het
Ik C T 18: 36,747,415 P51S possibly damaging Het
Irx1 A G 13: 71,963,485 S2P possibly damaging Het
Kng2 T A 16: 22,987,916 N511I probably damaging Het
Limk2 G T 11: 3,409,069 probably benign Het
Map1a T G 2: 121,301,142 V813G probably benign Het
Mast1 T C 8: 84,935,787 T31A probably damaging Het
N4bp2 T C 5: 65,790,240 F71S probably damaging Het
Neurod1 C T 2: 79,454,227 G271R probably damaging Het
Olfr686 T C 7: 105,204,191 I51V probably benign Het
Pcdhb22 A G 18: 37,518,601 T41A probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Pde9a T A 17: 31,473,223 D497E probably benign Het
Plaa A G 4: 94,589,932 S98P possibly damaging Het
Prl2c1 A G 13: 27,857,570 T192A probably benign Het
Ptpn18 T C 1: 34,469,813 probably benign Het
Rab27b C T 18: 69,994,514 V68I probably benign Het
Reep5 A G 18: 34,373,296 F9S probably damaging Het
Scaf11 T C 15: 96,415,917 N1328D probably damaging Het
Slc25a13 G A 6: 6,042,300 S626F probably damaging Het
Smg1 A G 7: 118,154,247 probably benign Het
Spock2 T A 10: 60,131,089 F332I probably benign Het
Tep1 C T 14: 50,845,434 R1039Q possibly damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Tradd T C 8: 105,259,268 Q217R probably benign Het
Vgll3 T A 16: 65,815,686 Y18* probably null Het
Vmn1r49 G T 6: 90,072,890 N43K probably benign Het
Vps50 A G 6: 3,517,808 N82S probably benign Het
Vstm2a A G 11: 16,261,460 D90G possibly damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wrnip1 A G 13: 32,816,312 D434G probably damaging Het
Zan C T 5: 137,406,921 probably benign Het
Zfp286 A G 11: 62,788,928 probably null Het
Zkscan17 A G 11: 59,493,227 V123A possibly damaging Het
Zkscan2 C G 7: 123,495,319 A211P possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
floored UTSW 17 30988057 nonsense probably null
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTCACCCGGAAGAAGAG -3'
(R):5'- AGGGAACAGAGCTTGTCACC -3'

Sequencing Primer
(F):5'- AAGAAGAGCAAGTGTTCTTGGCTG -3'
(R):5'- AGAGCTTGTCACCCCACTG -3'
Posted On2016-05-10