Incidental Mutation 'R4978:Pde9a'
ID384633
Institutional Source Beutler Lab
Gene Symbol Pde9a
Ensembl Gene ENSMUSG00000041119
Gene Namephosphodiesterase 9A
SynonymsPDE9A1
MMRRC Submission 042573-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R4978 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31386234-31476310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31473223 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 497 (D497E)
Ref Sequence ENSEMBL: ENSMUSP00000121003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047168] [ENSMUST00000124902] [ENSMUST00000127929] [ENSMUST00000131417] [ENSMUST00000134525] [ENSMUST00000137927] [ENSMUST00000143549]
Predicted Effect probably benign
Transcript: ENSMUST00000047168
AA Change: D523E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000038005
Gene: ENSMUSG00000041119
AA Change: D523E

DomainStartEndE-ValueType
HDc 248 415 7.12e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124902
SMART Domains Protein: ENSMUSP00000118869
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 77 3e-47 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000127929
AA Change: D523E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117611
Gene: ENSMUSG00000041119
AA Change: D523E

DomainStartEndE-ValueType
HDc 248 415 7.12e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131417
SMART Domains Protein: ENSMUSP00000115188
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 23 7e-9 PDB
low complexity region 32 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134525
AA Change: D497E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000121003
Gene: ENSMUSG00000041119
AA Change: D497E

DomainStartEndE-ValueType
HDc 222 389 7.12e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137927
Predicted Effect probably benign
Transcript: ENSMUST00000143549
SMART Domains Protein: ENSMUSP00000117911
Gene: ENSMUSG00000041119

DomainStartEndE-ValueType
PDB:3QI4|B 1 23 5e-9 PDB
low complexity region 32 43 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000154392
AA Change: D168E
SMART Domains Protein: ENSMUSP00000117065
Gene: ENSMUSG00000041119
AA Change: D168E

DomainStartEndE-ValueType
Pfam:PDEase_I 1 73 2.2e-20 PFAM
Pfam:PDEase_I 63 126 9.7e-15 PFAM
coiled coil region 128 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155113
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit suppressed pressure-overload-induced cardiac pathobiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,401 P673S probably damaging Het
Adam39 T C 8: 40,825,337 I255T possibly damaging Het
Adgrg6 A G 10: 14,420,461 F1093S probably damaging Het
Amer3 A G 1: 34,579,300 probably benign Het
Avil A T 10: 127,018,396 N744I probably benign Het
B430305J03Rik T C 3: 61,364,019 probably benign Het
Caps2 A T 10: 112,182,494 Q141L probably benign Het
Capza2 T A 6: 17,662,115 D201E probably null Het
Ccdc7b T C 8: 129,110,207 probably null Het
Clcn6 C T 4: 148,008,770 V818I probably benign Het
Cpeb4 C T 11: 31,931,509 H723Y probably null Het
Cspp1 T A 1: 10,083,517 F384I possibly damaging Het
Cyp2c50 T G 19: 40,098,057 V355G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpys A T 15: 39,826,936 D340E possibly damaging Het
Dsp T A 13: 38,182,234 L548Q probably damaging Het
Dyrk2 A T 10: 118,860,347 D335E probably benign Het
Etaa1 T C 11: 17,946,581 D512G probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fh1 A T 1: 175,603,967 M451K probably damaging Het
Flrt1 A G 19: 7,096,876 L102P probably damaging Het
Gins2 A G 8: 120,588,811 L40S possibly damaging Het
Gm5436 G A 12: 84,258,687 noncoding transcript Het
Gm7298 T G 6: 121,733,117 probably null Het
Gm7353 A G 7: 3,110,038 noncoding transcript Het
Gramd1a T C 7: 31,132,788 E608G possibly damaging Het
Hcls1 T C 16: 36,937,860 W38R probably damaging Het
Ik C T 18: 36,747,415 P51S possibly damaging Het
Irx1 A G 13: 71,963,485 S2P possibly damaging Het
Kng2 T A 16: 22,987,916 N511I probably damaging Het
Limk2 G T 11: 3,409,069 probably benign Het
Map1a T G 2: 121,301,142 V813G probably benign Het
Mast1 T C 8: 84,935,787 T31A probably damaging Het
N4bp2 T C 5: 65,790,240 F71S probably damaging Het
Neurod1 C T 2: 79,454,227 G271R probably damaging Het
Olfr686 T C 7: 105,204,191 I51V probably benign Het
Pcdhb22 A G 18: 37,518,601 T41A probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Plaa A G 4: 94,589,932 S98P possibly damaging Het
Prl2c1 A G 13: 27,857,570 T192A probably benign Het
Ptpn18 T C 1: 34,469,813 probably benign Het
Rab27b C T 18: 69,994,514 V68I probably benign Het
Reep5 A G 18: 34,373,296 F9S probably damaging Het
Scaf11 T C 15: 96,415,917 N1328D probably damaging Het
Slc25a13 G A 6: 6,042,300 S626F probably damaging Het
Smg1 A G 7: 118,154,247 probably benign Het
Spock2 T A 10: 60,131,089 F332I probably benign Het
Tep1 C T 14: 50,845,434 R1039Q possibly damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Tradd T C 8: 105,259,268 Q217R probably benign Het
Umodl1 T C 17: 30,986,081 I550T probably benign Het
Vgll3 T A 16: 65,815,686 Y18* probably null Het
Vmn1r49 G T 6: 90,072,890 N43K probably benign Het
Vps50 A G 6: 3,517,808 N82S probably benign Het
Vstm2a A G 11: 16,261,460 D90G possibly damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wrnip1 A G 13: 32,816,312 D434G probably damaging Het
Zan C T 5: 137,406,921 probably benign Het
Zfp286 A G 11: 62,788,928 probably null Het
Zkscan17 A G 11: 59,493,227 V123A possibly damaging Het
Zkscan2 C G 7: 123,495,319 A211P possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Pde9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Pde9a APN 17 31443172 missense probably benign 0.03
IGL01372:Pde9a APN 17 31461711 missense probably benign 0.24
IGL01599:Pde9a APN 17 31414150 missense probably damaging 1.00
IGL02108:Pde9a APN 17 31461693 missense probably benign
IGL02113:Pde9a APN 17 31459970 missense probably benign 0.24
IGL02132:Pde9a APN 17 31453470 missense probably benign 0.15
IGL02320:Pde9a APN 17 31459085 missense probably damaging 1.00
IGL02371:Pde9a APN 17 31420285 missense possibly damaging 0.92
IGL03128:Pde9a APN 17 31459910 missense possibly damaging 0.74
R0015:Pde9a UTSW 17 31386356 splice site probably null
R0281:Pde9a UTSW 17 31455106 missense probably damaging 0.98
R0584:Pde9a UTSW 17 31459977 missense probably damaging 1.00
R1464:Pde9a UTSW 17 31473162 missense probably benign 0.06
R1464:Pde9a UTSW 17 31473162 missense probably benign 0.06
R1853:Pde9a UTSW 17 31455120 missense probably damaging 1.00
R1855:Pde9a UTSW 17 31455120 missense probably damaging 1.00
R2134:Pde9a UTSW 17 31386310 missense probably damaging 1.00
R3732:Pde9a UTSW 17 31448427 missense possibly damaging 0.60
R4066:Pde9a UTSW 17 31443838 makesense probably null
R4841:Pde9a UTSW 17 31443161 splice site probably null
R4842:Pde9a UTSW 17 31443161 splice site probably null
R6826:Pde9a UTSW 17 31466440 missense probably benign 0.02
R6860:Pde9a UTSW 17 31470724 missense probably damaging 1.00
R6912:Pde9a UTSW 17 31466412 missense possibly damaging 0.95
R6963:Pde9a UTSW 17 31443887 missense probably benign 0.00
R6965:Pde9a UTSW 17 31443887 missense probably benign 0.00
R7188:Pde9a UTSW 17 31459097 missense probably damaging 0.96
R7208:Pde9a UTSW 17 31420284 missense possibly damaging 0.46
R7429:Pde9a UTSW 17 31470706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGCTCTGAGAGGACCTG -3'
(R):5'- AATCTCCACTGTGAGGTTAAAGG -3'

Sequencing Primer
(F):5'- GAGGACCTGAGTCTGCAATCCTAC -3'
(R):5'- GGATATCCCATGACTCAGTTTCTGG -3'
Posted On2016-05-10