Mutagenetix > Incidental Mutations

Incidental Mutation 'R4979:Cacna1e'

384646

Institutional Source

Beutler Lab

Gene Symbol

Cacna1e

Ensembl Gene

ENSMUSG00000004110

Gene Name

calcium channel, voltage-dependent, R type, alpha 1E subunit

Synonyms

Cchra1, alpha1E, Cav2.3

MMRRC Submission

042574-MU

Accession Numbers

Genbank: NM_009782; MGI: 106217

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R4979 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

154390731-154884501 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 154413993 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1821 (D1821G)

Ref Sequence

ENSEMBL: ENSMUSP00000140937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821] [ENSMUST00000226546]

Predicted Effect

probably benign
Transcript: ENSMUST00000004214
AA Change: D1513G

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: D1513G

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	55	6.7e-10	PFAM
Pfam:Ion_trans	168	407	3.3e-56	PFAM
Pfam:PKD_channel	257	401	3.3e-7	PFAM
low complexity region	409	414	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC
low complexity region	496	514	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC
low complexity region	626	640	N/A	INTRINSIC
coiled coil region	793	823	N/A	INTRINSIC
Pfam:Ion_trans	847	1128	2.3e-63	PFAM
Pfam:Ion_trans	1172	1429	2.6e-65	PFAM
Pfam:PKD_channel	1256	1424	2.8e-10	PFAM
Pfam:GPHH	1431	1500	1.3e-37	PFAM
Ca_chan_IQ	1555	1589	5.93e-13	SMART
low complexity region	1701	1717	N/A	INTRINSIC
low complexity region	1729	1742	N/A	INTRINSIC
low complexity region	1764	1780	N/A	INTRINSIC
low complexity region	1789	1804	N/A	INTRINSIC
low complexity region	1808	1822	N/A	INTRINSIC
low complexity region	1832	1846	N/A	INTRINSIC
low complexity region	1867	1878	N/A	INTRINSIC
low complexity region	1936	1946	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000187541
AA Change: D1821G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: D1821G

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	351	8.5e-54	PFAM
PDB:4DEX\|B	354	462	6e-36	PDB
Pfam:Ion_trans	511	703	2.2e-46	PFAM
Pfam:PKD_channel	565	710	1.4e-6	PFAM
low complexity region	717	722	N/A	INTRINSIC
low complexity region	763	777	N/A	INTRINSIC
low complexity region	804	822	N/A	INTRINSIC
low complexity region	912	928	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
coiled coil region	1101	1131	N/A	INTRINSIC
low complexity region	1162	1175	N/A	INTRINSIC
Pfam:Ion_trans	1191	1425	4.3e-55	PFAM
Pfam:Ion_trans	1515	1725	5.3e-60	PFAM
Pfam:PKD_channel	1565	1732	4.7e-10	PFAM
Ca_chan_IQ	1863	1897	5.93e-13	SMART
low complexity region	2009	2025	N/A	INTRINSIC
low complexity region	2037	2050	N/A	INTRINSIC
low complexity region	2072	2088	N/A	INTRINSIC
low complexity region	2097	2112	N/A	INTRINSIC
low complexity region	2116	2130	N/A	INTRINSIC
low complexity region	2140	2154	N/A	INTRINSIC
low complexity region	2175	2186	N/A	INTRINSIC
low complexity region	2244	2254	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211821
AA Change: D1759G

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226546
AA Change: D105G

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.2708

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	A	17: 9,001,811	E381K	probably damaging	Het
Abca1	T	C	4: 53,085,092		probably null	Het
Abca7	C	T	10: 80,004,783	Q870*	probably null	Het
Ambp	C	T	4: 63,152,651	V64M	probably benign	Het
Ank1	T	C	8: 23,132,196	V1542A	probably damaging	Het
Anln	T	C	9: 22,376,501	Y168C	probably benign	Het
Apoa4	T	A	9: 46,241,505	N29K	probably benign	Het
Arfgef1	T	C	1: 10,213,109	T192A	probably damaging	Het
Atad2b	G	T	12: 5,034,513	D1420Y	probably damaging	Het
Baiap3	A	G	17: 25,246,362	W648R	possibly damaging	Het
Bank1	A	G	3: 136,254,901	L198P	probably damaging	Het
Bicd2	A	G	13: 49,379,464	K509E	possibly damaging	Het
Ccdc80	G	A	16: 45,116,287	V692M	possibly damaging	Het
Ccdc88a	C	T	11: 29,482,133	Q308*	probably null	Het
Ccl8	T	C	11: 82,116,147	V62A	probably damaging	Het
Clspn	C	A	4: 126,578,386	P951Q	probably damaging	Het
Cngb1	T	A	8: 95,259,157	I858F	probably damaging	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Ctc1	C	T	11: 69,033,502	A960V	probably damaging	Het
Ctnnd2	A	G	15: 31,009,075	E1106G	probably damaging	Het
Dido1	C	T	2: 180,660,813	R1766H	probably damaging	Het
Dnajc13	G	T	9: 104,186,723	N1341K	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
E2f8	G	A	7: 48,875,170		probably benign	Het
Entpd8	A	G	2: 25,082,955	D91G	possibly damaging	Het
Fam69a	A	T	5: 107,909,534	L386*	probably null	Het
Fars2	A	G	13: 36,204,581	R18G	possibly damaging	Het
Fcgbp	A	G	7: 28,117,570	S2486G	probably benign	Het
Fibin	C	T	2: 110,362,618	D60N	possibly damaging	Het
Fpgs	A	G	2: 32,687,367		probably benign	Het
Galnt15	A	G	14: 32,043,290	D303G	probably damaging	Het
Gli3	C	A	13: 15,724,464	T812K	possibly damaging	Het
Gpbar1	G	C	1: 74,279,245	A216P	probably benign	Het
Grin2d	A	G	7: 45,857,933	I448T	probably benign	Het
Il21	C	A	3: 37,232,504	S21I	probably damaging	Het
Iqce	G	T	5: 140,691,621	D148E	probably damaging	Het
Iqcg	T	A	16: 33,019,514	E354V	probably damaging	Het
Iws1	T	C	18: 32,093,267		probably benign	Het
Ly75	C	T	2: 60,375,894	G144S	probably damaging	Het
Marco	C	A	1: 120,494,225	M83I	probably benign	Het
Mettl6	A	T	14: 31,479,795	L185H	probably damaging	Het
Mppe1	C	T	18: 67,229,702	G154D	probably damaging	Het
Mrpl42	T	C	10: 95,490,375	E85G	probably benign	Het
Neb	A	G	2: 52,189,909	V5518A	probably damaging	Het
Olfr103	A	T	17: 37,336,868	F121L	probably benign	Het
Olfr1458	A	T	19: 13,102,689	I199N	probably damaging	Het
Olfr656	T	A	7: 104,618,605	F317I	probably null	Het
Olfr77	G	T	9: 19,920,359	S50I	probably benign	Het
Olfr8	T	A	10: 78,955,932	C242*	probably null	Het
Perm1	A	G	4: 156,217,577	T193A	probably benign	Het
Prkd2	T	A	7: 16,848,727	C172S	probably damaging	Het
Prr23a3	T	A	9: 98,865,378	D128E	possibly damaging	Het
Prss28	A	G	17: 25,309,737	Y51C	probably damaging	Het
Psmb1	A	T	17: 15,476,189	M85K	probably benign	Het
Rae1	T	A	2: 173,012,608		probably benign	Het
Rasal1	A	G	5: 120,678,676	D759G	probably benign	Het
Rcvrn	G	A	11: 67,695,420	G2R	probably damaging	Het
Robo3	C	T	9: 37,423,344	A597T	probably damaging	Het
Rsf1	GCG	GCGACGGCGCCG	7: 97,579,907		probably benign	Homo
Sdcbp	T	A	4: 6,378,980	Y22*	probably null	Het
Sin3a	T	C	9: 57,118,076	F1069L	probably damaging	Het
Slitrk3	C	T	3: 73,049,796	V548I	possibly damaging	Het
Tbc1d22a	A	G	15: 86,391,086	H403R	probably damaging	Het
Tbr1	G	T	2: 61,805,249		probably null	Het
Tiam2	T	A	17: 3,505,710	D65E	probably damaging	Het
Tpcn2	A	G	7: 145,260,096	S488P	probably benign	Het
Trav9-2	T	C	14: 53,591,238	S22P	probably damaging	Het
Trim34a	T	A	7: 104,247,862	N44K	probably benign	Het
Unc79	C	G	12: 103,112,432	P1619A	probably benign	Het
Usp22	A	T	11: 61,157,216	V426E	probably damaging	Het
Vhl	A	T	6: 113,624,198	M20L	unknown	Het
Vmn1r215	G	A	13: 23,075,894	A35T	probably benign	Het
Vmn1r222	G	A	13: 23,232,432	L204F	possibly damaging	Het
Zfp871	A	T	17: 32,775,855	H115Q	probably damaging	Het
Zpr1	T	A	9: 46,278,342	F340L	probably benign	Het

Other mutations in Cacna1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Cacna1e	APN	1	154403683	missense	probably damaging	0.99
IGL01086:Cacna1e	APN	1	154471601	missense	probably benign	0.04
IGL01302:Cacna1e	APN	1	154443907	missense	probably damaging	1.00
IGL01386:Cacna1e	APN	1	154472377	missense	probably benign	0.18
IGL01573:Cacna1e	APN	1	154471367	missense	probably benign
IGL01676:Cacna1e	APN	1	154398476	missense	probably damaging	1.00
IGL01676:Cacna1e	APN	1	154412450	missense	probably damaging	1.00
IGL01762:Cacna1e	APN	1	154471373	missense	possibly damaging	0.78
IGL01801:Cacna1e	APN	1	154471340	missense	probably null	0.00
IGL01895:Cacna1e	APN	1	154443900	missense	probably damaging	1.00
IGL02391:Cacna1e	APN	1	154421113	missense	probably damaging	1.00
IGL02399:Cacna1e	APN	1	154403747	missense	probably damaging	1.00
IGL02659:Cacna1e	APN	1	154426528	missense	probably damaging	1.00
IGL02686:Cacna1e	APN	1	154493409	missense	probably damaging	1.00
IGL02838:Cacna1e	APN	1	154445648	missense	probably damaging	1.00
IGL02958:Cacna1e	APN	1	154465741	missense	probably damaging	1.00
IGL02981:Cacna1e	APN	1	154471425	missense	probably benign	0.15
IGL03120:Cacna1e	APN	1	154443881	missense	probably damaging	1.00
IGL03232:Cacna1e	APN	1	154493358	missense	probably damaging	1.00
IGL03310:Cacna1e	APN	1	154442251	missense	probably damaging	1.00
IGL03342:Cacna1e	APN	1	154466944	critical splice donor site	probably null
bezoar	UTSW	1	154436554	splice site	probably null
hairball	UTSW	1	154479305	missense	probably damaging	0.97
N/A - 535:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R0122:Cacna1e	UTSW	1	154443901	missense	probably damaging	1.00
R0143:Cacna1e	UTSW	1	154448947	splice site	probably null
R0314:Cacna1e	UTSW	1	154442251	missense	probably damaging	1.00
R0366:Cacna1e	UTSW	1	154416138	missense	probably benign	0.03
R0626:Cacna1e	UTSW	1	154488817	missense	probably damaging	0.99
R0739:Cacna1e	UTSW	1	154442278	missense	probably damaging	0.97
R1272:Cacna1e	UTSW	1	154444968	missense	probably damaging	1.00
R1300:Cacna1e	UTSW	1	154398673	missense	probably benign
R1340:Cacna1e	UTSW	1	154472657	missense	probably damaging	1.00
R1440:Cacna1e	UTSW	1	154561806	missense	possibly damaging	0.63
R1449:Cacna1e	UTSW	1	154485662	critical splice donor site	probably null
R1538:Cacna1e	UTSW	1	154561758	missense	probably damaging	0.99
R1542:Cacna1e	UTSW	1	154477779	missense	probably benign	0.01
R1560:Cacna1e	UTSW	1	154421104	nonsense	probably null
R1748:Cacna1e	UTSW	1	154486569	missense	possibly damaging	0.92
R1749:Cacna1e	UTSW	1	154444000	missense	probably damaging	1.00
R1912:Cacna1e	UTSW	1	154436449	missense	probably damaging	1.00
R1968:Cacna1e	UTSW	1	154700494	missense	probably damaging	1.00
R1993:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R1994:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R2191:Cacna1e	UTSW	1	154443845	missense	probably damaging	1.00
R2291:Cacna1e	UTSW	1	154403683	missense	probably damaging	0.99
R2417:Cacna1e	UTSW	1	154472193	missense	probably damaging	1.00
R3608:Cacna1e	UTSW	1	154416085	missense	probably benign	0.08
R3757:Cacna1e	UTSW	1	154633696	missense	probably damaging	0.97
R3890:Cacna1e	UTSW	1	154483553	missense	probably damaging	1.00
R4015:Cacna1e	UTSW	1	154482585	missense	probably damaging	1.00
R4088:Cacna1e	UTSW	1	154412183	splice site	probably null
R4275:Cacna1e	UTSW	1	154493325	missense	probably damaging	1.00
R4282:Cacna1e	UTSW	1	154426550	missense	probably benign	0.04
R4297:Cacna1e	UTSW	1	154398731	missense	probably benign	0.37
R4356:Cacna1e	UTSW	1	154443981	missense	probably damaging	1.00
R4510:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4511:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4577:Cacna1e	UTSW	1	154402027	missense	possibly damaging	0.92
R4590:Cacna1e	UTSW	1	154436519	missense	possibly damaging	0.87
R4601:Cacna1e	UTSW	1	154471613	missense	probably benign
R4622:Cacna1e	UTSW	1	154471565	missense	possibly damaging	0.81
R4626:Cacna1e	UTSW	1	154482548	splice site	probably null
R4694:Cacna1e	UTSW	1	154437266	critical splice donor site	probably null
R4727:Cacna1e	UTSW	1	154436468	nonsense	probably null
R4839:Cacna1e	UTSW	1	154421058	missense	probably damaging	1.00
R4851:Cacna1e	UTSW	1	154436554	splice site	probably null
R4894:Cacna1e	UTSW	1	154488805	nonsense	probably null
R4934:Cacna1e	UTSW	1	154481634	nonsense	probably null
R5077:Cacna1e	UTSW	1	154561729	critical splice donor site	probably null
R5128:Cacna1e	UTSW	1	154402021	missense	probably damaging	0.98
R5214:Cacna1e	UTSW	1	154701364	missense	possibly damaging	0.93
R5274:Cacna1e	UTSW	1	154700504	missense	probably damaging	0.98
R5388:Cacna1e	UTSW	1	154477796	missense	probably damaging	1.00
R5416:Cacna1e	UTSW	1	154465779	missense	probably damaging	1.00
R5469:Cacna1e	UTSW	1	154443937	missense	probably damaging	1.00
R5475:Cacna1e	UTSW	1	154725709	missense	possibly damaging	0.53
R5607:Cacna1e	UTSW	1	154471340	missense	probably benign	0.00
R5615:Cacna1e	UTSW	1	154412170	missense	probably damaging	1.00
R5616:Cacna1e	UTSW	1	154442194	missense	probably damaging	1.00
R5627:Cacna1e	UTSW	1	154635858	missense	probably damaging	0.98
R5707:Cacna1e	UTSW	1	154633717	missense	probably damaging	1.00
R5756:Cacna1e	UTSW	1	154471637	missense	probably benign	0.00
R5893:Cacna1e	UTSW	1	154437323	missense	probably damaging	1.00
R6117:Cacna1e	UTSW	1	154561791	missense	possibly damaging	0.68
R6134:Cacna1e	UTSW	1	154701291	missense	probably damaging	1.00
R6190:Cacna1e	UTSW	1	154486570	missense	possibly damaging	0.47
R6279:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6295:Cacna1e	UTSW	1	154442173	missense	probably damaging	0.98
R6300:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6320:Cacna1e	UTSW	1	154441524	missense	possibly damaging	0.76
R6375:Cacna1e	UTSW	1	154479305	missense	probably damaging	0.97
R6830:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R6842:Cacna1e	UTSW	1	154483117	missense	probably damaging	1.00
R7023:Cacna1e	UTSW	1	154725693	missense	probably null	0.85
R7081:Cacna1e	UTSW	1	154700383	missense	possibly damaging	0.82
R7085:Cacna1e	UTSW	1	154473746	splice site	probably null
R7108:Cacna1e	UTSW	1	154468995	frame shift	probably null
R7142:Cacna1e	UTSW	1	154412484	missense	probably damaging	1.00
R7250:Cacna1e	UTSW	1	154700489	missense	possibly damaging	0.93
R7332:Cacna1e	UTSW	1	154725801	missense	possibly damaging	0.89
R7410:Cacna1e	UTSW	1	154472234	missense	probably benign	0.13
R7502:Cacna1e	UTSW	1	154468988	missense	probably null	0.35
R7556:Cacna1e	UTSW	1	154472673	missense	probably benign	0.28
R7563:Cacna1e	UTSW	1	154471416	missense	probably benign	0.00
R7573:Cacna1e	UTSW	1	154726165	intron	probably benign
R7689:Cacna1e	UTSW	1	154398803	missense	probably benign	0.01
R7699:Cacna1e	UTSW	1	154443928	missense	probably damaging	1.00
R7744:Cacna1e	UTSW	1	154465792	missense	probably damaging	1.00
R7754:Cacna1e	UTSW	1	154413117	missense	probably damaging	0.97
R7787:Cacna1e	UTSW	1	154482568	missense	probably damaging	0.98
R7818:Cacna1e	UTSW	1	154398406	missense	probably damaging	1.00
R7838:Cacna1e	UTSW	1	154471403	missense	probably benign	0.08
R7849:Cacna1e	UTSW	1	154633718	missense	probably damaging	1.00
R8011:Cacna1e	UTSW	1	154465822	missense	probably benign	0.01
R8094:Cacna1e	UTSW	1	154561770	missense	probably damaging	1.00
R8162:Cacna1e	UTSW	1	154701567	splice site	probably null
R8202:Cacna1e	UTSW	1	154398449	missense	probably benign
R8280:Cacna1e	UTSW	1	154469093	missense	probably damaging	0.97
R8354:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R8385:Cacna1e	UTSW	1	154443941	missense	probably damaging	0.98
R8532:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
RF008:Cacna1e	UTSW	1	154442136	missense	probably damaging	1.00
X0062:Cacna1e	UTSW	1	154412492	missense	probably damaging	1.00
Z1176:Cacna1e	UTSW	1	154635850	missense	probably damaging	0.98
Z1177:Cacna1e	UTSW	1	154442292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGCATGGAATAGCAAGTC -3'
(R):5'- AGCTTTAGTGAGAAGCTGGG -3'

Sequencing Primer
(F):5'- TTTACCAAAGTAAGGACAAGTCTTC -3'
(R):5'- CGGACTGGCATGGGGATG -3'

Posted On

2016-05-10