Mutagenetix > Incidental Mutations

Incidental Mutation 'R4979:Tbr1'

384651

Institutional Source

Beutler Lab

Gene Symbol

Tbr1

Ensembl Gene

ENSMUSG00000035033

Gene Name

T-box brain gene 1

Synonyms

MMRRC Submission

042574-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4979 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61802930-61814114 bp(+) (GRCm38)

Type of Mutation

unclassified (4873 bp from exon)

DNA Base Change (assembly)

G to T at 61805249 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028278] [ENSMUST00000048934] [ENSMUST00000102737]

Predicted Effect

probably null
Transcript: ENSMUST00000028278

SMART Domains

Protein: ENSMUSP00000028278
Gene: ENSMUSG00000026914

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
JAB_MPN	30	165	3.71e-49	SMART
Pfam:MitMem_reg	173	307	9e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000048934
AA Change: G181V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000046787
Gene: ENSMUSG00000035033
AA Change: G181V

Domain	Start	End	E-Value	Type
low complexity region	108	122	N/A	INTRINSIC
TBOX	203	398	1.6e-125	SMART
Pfam:T-box_assoc	418	679	9.6e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102737

SMART Domains

Protein: ENSMUSP00000099798
Gene: ENSMUSG00000035033

Domain	Start	End	E-Value	Type
TBOX	1	135	5.05e-41	SMART
low complexity region	184	193	N/A	INTRINSIC
low complexity region	306	315	N/A	INTRINSIC
low complexity region	319	329	N/A	INTRINSIC
low complexity region	355	365	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136867

Meta Mutation Damage Score

0.3521

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted null allele fail to feed and die on the second postnatal day displaying disrupted forebrain morphology and a hypoplastic olfactory bulb that lacks normal mitral and tufted cells and shows a striking reduction in mature olfactory bulb projection neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	A	17: 9,001,811	E381K	probably damaging	Het
Abca1	T	C	4: 53,085,092		probably null	Het
Abca7	C	T	10: 80,004,783	Q870*	probably null	Het
Ambp	C	T	4: 63,152,651	V64M	probably benign	Het
Ank1	T	C	8: 23,132,196	V1542A	probably damaging	Het
Anln	T	C	9: 22,376,501	Y168C	probably benign	Het
Apoa4	T	A	9: 46,241,505	N29K	probably benign	Het
Arfgef1	T	C	1: 10,213,109	T192A	probably damaging	Het
Atad2b	G	T	12: 5,034,513	D1420Y	probably damaging	Het
Baiap3	A	G	17: 25,246,362	W648R	possibly damaging	Het
Bank1	A	G	3: 136,254,901	L198P	probably damaging	Het
Bicd2	A	G	13: 49,379,464	K509E	possibly damaging	Het
Cacna1e	T	C	1: 154,413,993	D1821G	probably damaging	Het
Ccdc80	G	A	16: 45,116,287	V692M	possibly damaging	Het
Ccdc88a	C	T	11: 29,482,133	Q308*	probably null	Het
Ccl8	T	C	11: 82,116,147	V62A	probably damaging	Het
Clspn	C	A	4: 126,578,386	P951Q	probably damaging	Het
Cngb1	T	A	8: 95,259,157	I858F	probably damaging	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Ctc1	C	T	11: 69,033,502	A960V	probably damaging	Het
Ctnnd2	A	G	15: 31,009,075	E1106G	probably damaging	Het
Dido1	C	T	2: 180,660,813	R1766H	probably damaging	Het
Dnajc13	G	T	9: 104,186,723	N1341K	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
E2f8	G	A	7: 48,875,170		probably benign	Het
Entpd8	A	G	2: 25,082,955	D91G	possibly damaging	Het
Fam69a	A	T	5: 107,909,534	L386*	probably null	Het
Fars2	A	G	13: 36,204,581	R18G	possibly damaging	Het
Fcgbp	A	G	7: 28,117,570	S2486G	probably benign	Het
Fibin	C	T	2: 110,362,618	D60N	possibly damaging	Het
Fpgs	A	G	2: 32,687,367		probably benign	Het
Galnt15	A	G	14: 32,043,290	D303G	probably damaging	Het
Gli3	C	A	13: 15,724,464	T812K	possibly damaging	Het
Gpbar1	G	C	1: 74,279,245	A216P	probably benign	Het
Grin2d	A	G	7: 45,857,933	I448T	probably benign	Het
Il21	C	A	3: 37,232,504	S21I	probably damaging	Het
Iqce	G	T	5: 140,691,621	D148E	probably damaging	Het
Iqcg	T	A	16: 33,019,514	E354V	probably damaging	Het
Iws1	T	C	18: 32,093,267		probably benign	Het
Ly75	C	T	2: 60,375,894	G144S	probably damaging	Het
Marco	C	A	1: 120,494,225	M83I	probably benign	Het
Mettl6	A	T	14: 31,479,795	L185H	probably damaging	Het
Mppe1	C	T	18: 67,229,702	G154D	probably damaging	Het
Mrpl42	T	C	10: 95,490,375	E85G	probably benign	Het
Neb	A	G	2: 52,189,909	V5518A	probably damaging	Het
Olfr103	A	T	17: 37,336,868	F121L	probably benign	Het
Olfr1458	A	T	19: 13,102,689	I199N	probably damaging	Het
Olfr656	T	A	7: 104,618,605	F317I	probably null	Het
Olfr77	G	T	9: 19,920,359	S50I	probably benign	Het
Olfr8	T	A	10: 78,955,932	C242*	probably null	Het
Perm1	A	G	4: 156,217,577	T193A	probably benign	Het
Prkd2	T	A	7: 16,848,727	C172S	probably damaging	Het
Prr23a3	T	A	9: 98,865,378	D128E	possibly damaging	Het
Prss28	A	G	17: 25,309,737	Y51C	probably damaging	Het
Psmb1	A	T	17: 15,476,189	M85K	probably benign	Het
Rae1	T	A	2: 173,012,608		probably benign	Het
Rasal1	A	G	5: 120,678,676	D759G	probably benign	Het
Rcvrn	G	A	11: 67,695,420	G2R	probably damaging	Het
Robo3	C	T	9: 37,423,344	A597T	probably damaging	Het
Rsf1	GCG	GCGACGGCGCCG	7: 97,579,907		probably benign	Homo
Sdcbp	T	A	4: 6,378,980	Y22*	probably null	Het
Sin3a	T	C	9: 57,118,076	F1069L	probably damaging	Het
Slitrk3	C	T	3: 73,049,796	V548I	possibly damaging	Het
Tbc1d22a	A	G	15: 86,391,086	H403R	probably damaging	Het
Tiam2	T	A	17: 3,505,710	D65E	probably damaging	Het
Tpcn2	A	G	7: 145,260,096	S488P	probably benign	Het
Trav9-2	T	C	14: 53,591,238	S22P	probably damaging	Het
Trim34a	T	A	7: 104,247,862	N44K	probably benign	Het
Unc79	C	G	12: 103,112,432	P1619A	probably benign	Het
Usp22	A	T	11: 61,157,216	V426E	probably damaging	Het
Vhl	A	T	6: 113,624,198	M20L	unknown	Het
Vmn1r215	G	A	13: 23,075,894	A35T	probably benign	Het
Vmn1r222	G	A	13: 23,232,432	L204F	possibly damaging	Het
Zfp871	A	T	17: 32,775,855	H115Q	probably damaging	Het
Zpr1	T	A	9: 46,278,342	F340L	probably benign	Het

Other mutations in Tbr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Tbr1	APN	2	61805281	missense	probably benign	0.14
IGL01309:Tbr1	APN	2	61806067	missense	possibly damaging	0.92
IGL02161:Tbr1	APN	2	61805239	nonsense	probably null
IGL02256:Tbr1	APN	2	61804874	missense	probably damaging	0.99
IGL02336:Tbr1	APN	2	61804992	missense	possibly damaging	0.93
IGL02526:Tbr1	APN	2	61811698	missense	probably benign	0.00
FR4340:Tbr1	UTSW	2	61806347	intron	probably benign
R0594:Tbr1	UTSW	2	61811620	missense	possibly damaging	0.49
R0847:Tbr1	UTSW	2	61805029	missense	probably benign	0.00
R1101:Tbr1	UTSW	2	61804739	missense	probably benign	0.00
R1247:Tbr1	UTSW	2	61811618	missense	possibly damaging	0.78
R1944:Tbr1	UTSW	2	61812256	missense	probably damaging	1.00
R3080:Tbr1	UTSW	2	61807291	nonsense	probably null
R4110:Tbr1	UTSW	2	61811732	missense	probably benign	0.18
R4111:Tbr1	UTSW	2	61811732	missense	probably benign	0.18
R4440:Tbr1	UTSW	2	61804838	missense	possibly damaging	0.92
R4790:Tbr1	UTSW	2	61811588	missense	probably benign	0.04
R5054:Tbr1	UTSW	2	61806002	missense	possibly damaging	0.83
R5283:Tbr1	UTSW	2	61804900	missense	probably benign	0.00
R5545:Tbr1	UTSW	2	61807376	missense	possibly damaging	0.93
R6178:Tbr1	UTSW	2	61804815	missense	possibly damaging	0.91
R6290:Tbr1	UTSW	2	61805050	missense	probably benign
R6389:Tbr1	UTSW	2	61806287	start gained	probably benign
R6637:Tbr1	UTSW	2	61811630	missense	probably benign	0.17
R6983:Tbr1	UTSW	2	61811735	missense	probably damaging	1.00
R7021:Tbr1	UTSW	2	61807344	missense	probably benign	0.18
R7112:Tbr1	UTSW	2	61811816	missense	probably benign	0.02
R7254:Tbr1	UTSW	2	61806042	missense	probably damaging	1.00
R7291:Tbr1	UTSW	2	61812256	missense	probably damaging	1.00
R7438:Tbr1	UTSW	2	61804817	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCTGCAGATCGTTACCTACTC -3'
(R):5'- GCAGCCAAGAAAGTAGCATTAC -3'

Sequencing Primer
(F):5'- GCAGATCGTTACCTACTCTCTCAG -3'
(R):5'- AGAAAGTAGCATTACCTTCCCTG -3'

Posted On

2016-05-10