Incidental Mutation 'R4979:Dido1'
ID384654
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Namedeath inducer-obliterator 1
Synonyms6720461J16Rik, DIO-1, Datf1, D130048F08Rik
MMRRC Submission 042574-MU
Accession Numbers

Genbank: NM_175551; MGI: 1344352

Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4979 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180657964-180709999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 180660813 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1766 (R1766H)
Ref Sequence ENSEMBL: ENSMUSP00000084794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087517]
Predicted Effect probably damaging
Transcript: ENSMUST00000087517
AA Change: R1766H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: R1766H

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180683989 missense probably benign
IGL00834:Dido1 APN 2 180689526 missense possibly damaging 0.87
IGL01317:Dido1 APN 2 180671757 missense probably benign 0.17
IGL01588:Dido1 APN 2 180688875 missense probably benign 0.00
IGL01834:Dido1 APN 2 180684031 splice site probably benign
IGL02102:Dido1 APN 2 180662247 missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180689335 missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180661923 missense probably benign 0.00
IGL02826:Dido1 APN 2 180683958 missense probably benign
IGL02970:Dido1 APN 2 180689415 missense probably damaging 0.99
IGL03110:Dido1 APN 2 180689342 missense probably damaging 1.00
IGL03116:Dido1 APN 2 180670979 missense probably damaging 1.00
3370:Dido1 UTSW 2 180671542 missense probably benign
A4554:Dido1 UTSW 2 180675371 missense probably damaging 1.00
H8441:Dido1 UTSW 2 180689014 missense probably benign 0.12
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0127:Dido1 UTSW 2 180671824 missense probably benign 0.01
R0620:Dido1 UTSW 2 180659851 missense probably benign 0.26
R0734:Dido1 UTSW 2 180660042 missense probably benign 0.01
R1390:Dido1 UTSW 2 180685124 missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180671470 missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1472:Dido1 UTSW 2 180660720 missense probably benign 0.02
R1538:Dido1 UTSW 2 180684970 missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R2020:Dido1 UTSW 2 180659585 missense unknown
R2025:Dido1 UTSW 2 180689181 nonsense probably null
R2026:Dido1 UTSW 2 180689181 nonsense probably null
R2027:Dido1 UTSW 2 180689181 nonsense probably null
R2089:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2495:Dido1 UTSW 2 180689388 missense probably benign 0.00
R2931:Dido1 UTSW 2 180661653 missense probably damaging 1.00
R3418:Dido1 UTSW 2 180660935 missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180684036 splice site probably benign
R4523:Dido1 UTSW 2 180672292 missense probably damaging 1.00
R4674:Dido1 UTSW 2 180687559 missense probably damaging 0.97
R4729:Dido1 UTSW 2 180687650 missense probably benign 0.00
R4762:Dido1 UTSW 2 180689575 missense probably damaging 1.00
R4786:Dido1 UTSW 2 180670871 missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180661416 missense probably benign 0.02
R4892:Dido1 UTSW 2 180675029 nonsense probably null
R5510:Dido1 UTSW 2 180685173 missense probably benign 0.00
R5586:Dido1 UTSW 2 180659652 nonsense probably null
R5672:Dido1 UTSW 2 180671903 missense probably damaging 0.99
R5863:Dido1 UTSW 2 180661773 missense probably benign 0.02
R5943:Dido1 UTSW 2 180661882 missense probably benign 0.00
R5974:Dido1 UTSW 2 180671497 missense probably benign 0.02
R6123:Dido1 UTSW 2 180683967 missense probably benign 0.07
R6214:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6215:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6248:Dido1 UTSW 2 180660255 missense probably damaging 1.00
R6285:Dido1 UTSW 2 180661147 missense probably benign 0.00
R6349:Dido1 UTSW 2 180660701 missense probably benign 0.03
R6437:Dido1 UTSW 2 180675013 missense probably damaging 1.00
R6477:Dido1 UTSW 2 180660481 missense probably benign 0.00
R6836:Dido1 UTSW 2 180662307 missense probably benign 0.16
R7055:Dido1 UTSW 2 180661209 missense probably benign 0.09
R7289:Dido1 UTSW 2 180659631 missense unknown
R7304:Dido1 UTSW 2 180687493 missense probably damaging 1.00
R7343:Dido1 UTSW 2 180675121 missense possibly damaging 0.49
R7363:Dido1 UTSW 2 180662517 nonsense probably null
R7429:Dido1 UTSW 2 180689526 missense possibly damaging 0.87
R7594:Dido1 UTSW 2 180675112 missense probably benign
R7629:Dido1 UTSW 2 180661473 missense probably benign
R7899:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R7946:Dido1 UTSW 2 180661708 missense possibly damaging 0.81
R7951:Dido1 UTSW 2 180670881 missense probably benign 0.01
R8033:Dido1 UTSW 2 180674842 missense probably damaging 1.00
R8069:Dido1 UTSW 2 180660912 missense probably benign
R8331:Dido1 UTSW 2 180660449 missense probably benign 0.00
R8479:Dido1 UTSW 2 180673229 critical splice donor site probably null
V1024:Dido1 UTSW 2 180689014 missense probably benign 0.12
X0011:Dido1 UTSW 2 180660834 missense probably benign 0.00
X0019:Dido1 UTSW 2 180671572 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCATGTTGCCCAGAGAATAAGG -3'
(R):5'- CAGGGCCCACATTTATGTCTC -3'

Sequencing Primer
(F):5'- ATAAGGAAGGGATTGGTGGCTTC -3'
(R):5'- ATGTCTCAGGAAACATCTCTTGGC -3'
Posted On2016-05-10