Incidental Mutation 'R4979:Il21'
ID 384655
Institutional Source Beutler Lab
Gene Symbol Il21
Ensembl Gene ENSMUSG00000027718
Gene Name interleukin 21
Synonyms
MMRRC Submission 042574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4979 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 37222759-37232636 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37232504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 21 (S21I)
Ref Sequence ENSEMBL: ENSMUSP00000124668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029273] [ENSMUST00000161015]
AlphaFold Q9ES17
Predicted Effect probably damaging
Transcript: ENSMUST00000029273
AA Change: S21I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029273
Gene: ENSMUSG00000027718
AA Change: S21I

DomainStartEndE-ValueType
Pfam:IL15 4 142 7.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147691
Predicted Effect probably damaging
Transcript: ENSMUST00000161015
AA Change: S21I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124668
Gene: ENSMUSG00000027718
AA Change: S21I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
PDB:3TGX|P 39 140 8e-36 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200285
Meta Mutation Damage Score 0.3018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene develop normally and have a normal life span. One allele exhibits enhanced IgE isotype switch and IgE production after antigen immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Sin3a T C 9: 57,118,076 F1069L probably damaging Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Il21
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0433:Il21 UTSW 3 37232535 missense possibly damaging 0.46
R0579:Il21 UTSW 3 37227774 missense possibly damaging 0.65
R1641:Il21 UTSW 3 37232532 missense probably benign 0.00
R1741:Il21 UTSW 3 37227662 missense probably benign 0.00
R1754:Il21 UTSW 3 37225525 missense possibly damaging 0.93
R1933:Il21 UTSW 3 37232486 missense probably benign
R4560:Il21 UTSW 3 37225484 nonsense probably null
R4975:Il21 UTSW 3 37232504 missense probably damaging 0.99
R4977:Il21 UTSW 3 37232504 missense probably damaging 0.99
R5254:Il21 UTSW 3 37227735 missense possibly damaging 0.94
R5267:Il21 UTSW 3 37227797 missense probably benign
R5641:Il21 UTSW 3 37227768 nonsense probably null
R7058:Il21 UTSW 3 37232480 missense probably damaging 1.00
R7259:Il21 UTSW 3 37227654 critical splice donor site probably null
R9039:Il21 UTSW 3 37232453 missense probably benign
R9249:Il21 UTSW 3 37225528 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCAAAGAGTATTAGTTCTGAGTTGGTG -3'
(R):5'- AAAGATTTCCAGGCTGCAATGG -3'

Sequencing Primer
(F):5'- TTGGTGATACAAGTCAAAAGGCTCC -3'
(R):5'- CAATGGGAGGGCTTGGC -3'
Posted On 2016-05-10