Incidental Mutation 'R4979:Sdcbp'
ID 384658
Institutional Source Beutler Lab
Gene Symbol Sdcbp
Ensembl Gene ENSMUSG00000028249
Gene Name syndecan binding protein
Synonyms syntenin-1, Sycl, MDA-9, syndecan interacting protein, syntenin
MMRRC Submission 042574-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R4979 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 6365654-6396122 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 6378980 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 22 (Y22*)
Ref Sequence ENSEMBL: ENSMUSP00000135777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029912] [ENSMUST00000103008] [ENSMUST00000108374] [ENSMUST00000140830] [ENSMUST00000153861] [ENSMUST00000175769]
AlphaFold O08992
Predicted Effect probably null
Transcript: ENSMUST00000029912
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000029912
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
PDZ 208 274 6.04e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103008
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000100073
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
PDZ 207 273 6.04e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108371
Predicted Effect probably null
Transcript: ENSMUST00000108374
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000104011
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 124 195 2.84e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140830
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000122411
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
Blast:PDZ 56 91 1e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000153861
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000119838
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155247
Predicted Effect probably null
Transcript: ENSMUST00000175769
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000135777
Gene: ENSMUSG00000028249
AA Change: Y22*

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
Blast:PDZ 208 249 1e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193139
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was initially identified as a molecule linking syndecan-mediated signaling to the cytoskeleton. The syntenin protein contains tandemly repeated PDZ domains that bind the cytoplasmic, C-terminal domains of a variety of transmembrane proteins. This protein may also affect cytoskeletal-membrane organization, cell adhesion, protein trafficking, and the activation of transcription factors. The protein is primarily localized to membrane-associated adherens junctions and focal adhesions but is also found at the endoplasmic reticulum and nucleus. Alternative splicing results in multiple transcript variants encoding different isoforms. Related pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice heterozygous for a conditional allele activated in neurons exhibit abnormal dendrite morphology and reduced mEPSC frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,220,643 (GRCm39) E381K probably damaging Het
Abca1 T C 4: 53,085,092 (GRCm39) probably null Het
Abca7 C T 10: 79,840,617 (GRCm39) Q870* probably null Het
Ambp C T 4: 63,070,888 (GRCm39) V64M probably benign Het
Ank1 T C 8: 23,622,212 (GRCm39) V1542A probably damaging Het
Anln T C 9: 22,287,797 (GRCm39) Y168C probably benign Het
Apoa4 T A 9: 46,152,803 (GRCm39) N29K probably benign Het
Arfgef1 T C 1: 10,283,334 (GRCm39) T192A probably damaging Het
Atad2b G T 12: 5,084,513 (GRCm39) D1420Y probably damaging Het
Baiap3 A G 17: 25,465,336 (GRCm39) W648R possibly damaging Het
Bank1 A G 3: 135,960,662 (GRCm39) L198P probably damaging Het
Bicd2 A G 13: 49,532,940 (GRCm39) K509E possibly damaging Het
Cacna1e T C 1: 154,289,739 (GRCm39) D1821G probably damaging Het
Ccdc80 G A 16: 44,936,650 (GRCm39) V692M possibly damaging Het
Ccdc88a C T 11: 29,432,133 (GRCm39) Q308* probably null Het
Ccl8 T C 11: 82,006,973 (GRCm39) V62A probably damaging Het
Clspn C A 4: 126,472,179 (GRCm39) P951Q probably damaging Het
Cngb1 T A 8: 95,985,785 (GRCm39) I858F probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Ctc1 C T 11: 68,924,328 (GRCm39) A960V probably damaging Het
Ctnnd2 A G 15: 31,009,221 (GRCm39) E1106G probably damaging Het
Dido1 C T 2: 180,302,606 (GRCm39) R1766H probably damaging Het
Dipk1a A T 5: 108,057,400 (GRCm39) L386* probably null Het
Dnajc13 G T 9: 104,063,922 (GRCm39) N1341K probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
E2f8 G A 7: 48,524,918 (GRCm39) probably benign Het
Entpd8 A G 2: 24,972,967 (GRCm39) D91G possibly damaging Het
Fars2 A G 13: 36,388,564 (GRCm39) R18G possibly damaging Het
Fcgbp A G 7: 27,816,995 (GRCm39) S2486G probably benign Het
Fibin C T 2: 110,192,963 (GRCm39) D60N possibly damaging Het
Fpgs A G 2: 32,577,379 (GRCm39) probably benign Het
Galnt15 A G 14: 31,765,247 (GRCm39) D303G probably damaging Het
Gli3 C A 13: 15,899,049 (GRCm39) T812K possibly damaging Het
Gpbar1 G C 1: 74,318,404 (GRCm39) A216P probably benign Het
Grin2d A G 7: 45,507,357 (GRCm39) I448T probably benign Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Iqce G T 5: 140,677,376 (GRCm39) D148E probably damaging Het
Iqcg T A 16: 32,839,884 (GRCm39) E354V probably damaging Het
Iws1 T C 18: 32,226,320 (GRCm39) probably benign Het
Ly75 C T 2: 60,206,238 (GRCm39) G144S probably damaging Het
Marco C A 1: 120,421,954 (GRCm39) M83I probably benign Het
Mettl6 A T 14: 31,201,752 (GRCm39) L185H probably damaging Het
Mppe1 C T 18: 67,362,773 (GRCm39) G154D probably damaging Het
Mrpl42 T C 10: 95,326,237 (GRCm39) E85G probably benign Het
Neb A G 2: 52,079,921 (GRCm39) V5518A probably damaging Het
Or12d13 A T 17: 37,647,759 (GRCm39) F121L probably benign Het
Or52p1 T A 7: 104,267,812 (GRCm39) F317I probably null Het
Or5b105 A T 19: 13,080,053 (GRCm39) I199N probably damaging Het
Or7a42 T A 10: 78,791,766 (GRCm39) C242* probably null Het
Or7d10 G T 9: 19,831,655 (GRCm39) S50I probably benign Het
Perm1 A G 4: 156,302,034 (GRCm39) T193A probably benign Het
Prkd2 T A 7: 16,582,652 (GRCm39) C172S probably damaging Het
Prr23a3 T A 9: 98,747,431 (GRCm39) D128E possibly damaging Het
Prss28 A G 17: 25,528,711 (GRCm39) Y51C probably damaging Het
Psmb1 A T 17: 15,696,451 (GRCm39) M85K probably benign Het
Rae1 T A 2: 172,854,401 (GRCm39) probably benign Het
Rasal1 A G 5: 120,816,741 (GRCm39) D759G probably benign Het
Rcvrn G A 11: 67,586,246 (GRCm39) G2R probably damaging Het
Robo3 C T 9: 37,334,640 (GRCm39) A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,229,114 (GRCm39) probably benign Homo
Sin3a T C 9: 57,025,360 (GRCm39) F1069L probably damaging Het
Slitrk3 C T 3: 72,957,129 (GRCm39) V548I possibly damaging Het
Tbc1d22a A G 15: 86,275,287 (GRCm39) H403R probably damaging Het
Tbr1 G T 2: 61,635,593 (GRCm39) probably null Het
Tiam2 T A 17: 3,555,985 (GRCm39) D65E probably damaging Het
Tpcn2 A G 7: 144,813,833 (GRCm39) S488P probably benign Het
Trav9-2 T C 14: 53,828,695 (GRCm39) S22P probably damaging Het
Trim34a T A 7: 103,897,069 (GRCm39) N44K probably benign Het
Unc79 C G 12: 103,078,691 (GRCm39) P1619A probably benign Het
Usp22 A T 11: 61,048,042 (GRCm39) V426E probably damaging Het
Vhl A T 6: 113,601,159 (GRCm39) M20L unknown Het
Vmn1r215 G A 13: 23,260,064 (GRCm39) A35T probably benign Het
Vmn1r222 G A 13: 23,416,602 (GRCm39) L204F possibly damaging Het
Zfp871 A T 17: 32,994,829 (GRCm39) H115Q probably damaging Het
Zpr1 T A 9: 46,189,640 (GRCm39) F340L probably benign Het
Other mutations in Sdcbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Sdcbp APN 4 6,392,953 (GRCm39) nonsense probably null
R0158:Sdcbp UTSW 4 6,379,042 (GRCm39) missense possibly damaging 0.81
R1066:Sdcbp UTSW 4 6,385,120 (GRCm39) missense probably damaging 0.98
R1115:Sdcbp UTSW 4 6,377,143 (GRCm39) critical splice donor site probably null
R1353:Sdcbp UTSW 4 6,381,057 (GRCm39) missense probably damaging 0.99
R2006:Sdcbp UTSW 4 6,386,536 (GRCm39) missense probably benign 0.23
R4879:Sdcbp UTSW 4 6,381,056 (GRCm39) missense possibly damaging 0.93
R5034:Sdcbp UTSW 4 6,393,118 (GRCm39) critical splice donor site probably null
R5072:Sdcbp UTSW 4 6,393,019 (GRCm39) missense probably benign 0.07
R6307:Sdcbp UTSW 4 6,385,059 (GRCm39) missense probably benign 0.06
R6329:Sdcbp UTSW 4 6,381,064 (GRCm39) missense probably benign 0.04
R7483:Sdcbp UTSW 4 6,393,089 (GRCm39) missense possibly damaging 0.95
R7665:Sdcbp UTSW 4 6,385,144 (GRCm39) missense probably benign 0.11
R7722:Sdcbp UTSW 4 6,385,063 (GRCm39) missense possibly damaging 0.93
R7729:Sdcbp UTSW 4 6,378,985 (GRCm39) missense probably benign 0.06
R7807:Sdcbp UTSW 4 6,393,688 (GRCm39) missense probably damaging 1.00
R8025:Sdcbp UTSW 4 6,393,022 (GRCm39) missense probably benign 0.09
R8941:Sdcbp UTSW 4 6,393,661 (GRCm39) missense probably benign 0.22
R9093:Sdcbp UTSW 4 6,386,709 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTTTGGGTGAAAATGATTTCTG -3'
(R):5'- AGACTCACCTTCATACTCAAAGATCA -3'

Sequencing Primer
(F):5'- TGGGTGAAAATGATTTCTGAACTG -3'
(R):5'- TACTTCCATCTGGAGGGAG -3'
Posted On 2016-05-10