Mutagenetix > Incidental Mutation

Incidental Mutation 'R4979:Abca1'

384659

Institutional Source

Beutler Lab

Gene Symbol

Abca1

Ensembl Gene

ENSMUSG00000015243

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 1

Synonyms

ABC1

MMRRC Submission

042574-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4979 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53030787-53159895 bp(-) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

T to C at 53085092 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000030010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030010]

AlphaFold

P41233

Predicted Effect

probably null
Transcript: ENSMUST00000030010

SMART Domains

Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
Pfam:ABC2_membrane_3	395	841	4.9e-14	PFAM
AAA	925	1122	4.2e-10	SMART
low complexity region	1137	1150	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1344	1869	1.7e-53	PFAM
low complexity region	1890	1899	N/A	INTRINSIC
AAA	1938	2123	3.04e-7	SMART
low complexity region	2176	2187	N/A	INTRINSIC
low complexity region	2222	2237	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	A	17: 9,001,811	E381K	probably damaging	Het
Abca7	C	T	10: 80,004,783	Q870*	probably null	Het
Ambp	C	T	4: 63,152,651	V64M	probably benign	Het
Ank1	T	C	8: 23,132,196	V1542A	probably damaging	Het
Anln	T	C	9: 22,376,501	Y168C	probably benign	Het
Apoa4	T	A	9: 46,241,505	N29K	probably benign	Het
Arfgef1	T	C	1: 10,213,109	T192A	probably damaging	Het
Atad2b	G	T	12: 5,034,513	D1420Y	probably damaging	Het
Baiap3	A	G	17: 25,246,362	W648R	possibly damaging	Het
Bank1	A	G	3: 136,254,901	L198P	probably damaging	Het
Bicd2	A	G	13: 49,379,464	K509E	possibly damaging	Het
Cacna1e	T	C	1: 154,413,993	D1821G	probably damaging	Het
Ccdc80	G	A	16: 45,116,287	V692M	possibly damaging	Het
Ccdc88a	C	T	11: 29,482,133	Q308*	probably null	Het
Ccl8	T	C	11: 82,116,147	V62A	probably damaging	Het
Clspn	C	A	4: 126,578,386	P951Q	probably damaging	Het
Cngb1	T	A	8: 95,259,157	I858F	probably damaging	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Ctc1	C	T	11: 69,033,502	A960V	probably damaging	Het
Ctnnd2	A	G	15: 31,009,075	E1106G	probably damaging	Het
Dido1	C	T	2: 180,660,813	R1766H	probably damaging	Het
Dnajc13	G	T	9: 104,186,723	N1341K	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
E2f8	G	A	7: 48,875,170		probably benign	Het
Entpd8	A	G	2: 25,082,955	D91G	possibly damaging	Het
Fam69a	A	T	5: 107,909,534	L386*	probably null	Het
Fars2	A	G	13: 36,204,581	R18G	possibly damaging	Het
Fcgbp	A	G	7: 28,117,570	S2486G	probably benign	Het
Fibin	C	T	2: 110,362,618	D60N	possibly damaging	Het
Fpgs	A	G	2: 32,687,367		probably benign	Het
Galnt15	A	G	14: 32,043,290	D303G	probably damaging	Het
Gli3	C	A	13: 15,724,464	T812K	possibly damaging	Het
Gpbar1	G	C	1: 74,279,245	A216P	probably benign	Het
Grin2d	A	G	7: 45,857,933	I448T	probably benign	Het
Il21	C	A	3: 37,232,504	S21I	probably damaging	Het
Iqce	G	T	5: 140,691,621	D148E	probably damaging	Het
Iqcg	T	A	16: 33,019,514	E354V	probably damaging	Het
Iws1	T	C	18: 32,093,267		probably benign	Het
Ly75	C	T	2: 60,375,894	G144S	probably damaging	Het
Marco	C	A	1: 120,494,225	M83I	probably benign	Het
Mettl6	A	T	14: 31,479,795	L185H	probably damaging	Het
Mppe1	C	T	18: 67,229,702	G154D	probably damaging	Het
Mrpl42	T	C	10: 95,490,375	E85G	probably benign	Het
Neb	A	G	2: 52,189,909	V5518A	probably damaging	Het
Olfr103	A	T	17: 37,336,868	F121L	probably benign	Het
Olfr1458	A	T	19: 13,102,689	I199N	probably damaging	Het
Olfr656	T	A	7: 104,618,605	F317I	probably null	Het
Olfr77	G	T	9: 19,920,359	S50I	probably benign	Het
Olfr8	T	A	10: 78,955,932	C242*	probably null	Het
Perm1	A	G	4: 156,217,577	T193A	probably benign	Het
Prkd2	T	A	7: 16,848,727	C172S	probably damaging	Het
Prr23a3	T	A	9: 98,865,378	D128E	possibly damaging	Het
Prss28	A	G	17: 25,309,737	Y51C	probably damaging	Het
Psmb1	A	T	17: 15,476,189	M85K	probably benign	Het
Rae1	T	A	2: 173,012,608		probably benign	Het
Rasal1	A	G	5: 120,678,676	D759G	probably benign	Het
Rcvrn	G	A	11: 67,695,420	G2R	probably damaging	Het
Robo3	C	T	9: 37,423,344	A597T	probably damaging	Het
Rsf1	GCG	GCGACGGCGCCG	7: 97,579,907		probably benign	Homo
Sdcbp	T	A	4: 6,378,980	Y22*	probably null	Het
Sin3a	T	C	9: 57,118,076	F1069L	probably damaging	Het
Slitrk3	C	T	3: 73,049,796	V548I	possibly damaging	Het
Tbc1d22a	A	G	15: 86,391,086	H403R	probably damaging	Het
Tbr1	G	T	2: 61,805,249		probably null	Het
Tiam2	T	A	17: 3,505,710	D65E	probably damaging	Het
Tpcn2	A	G	7: 145,260,096	S488P	probably benign	Het
Trav9-2	T	C	14: 53,591,238	S22P	probably damaging	Het
Trim34a	T	A	7: 104,247,862	N44K	probably benign	Het
Unc79	C	G	12: 103,112,432	P1619A	probably benign	Het
Usp22	A	T	11: 61,157,216	V426E	probably damaging	Het
Vhl	A	T	6: 113,624,198	M20L	unknown	Het
Vmn1r215	G	A	13: 23,075,894	A35T	probably benign	Het
Vmn1r222	G	A	13: 23,232,432	L204F	possibly damaging	Het
Zfp871	A	T	17: 32,775,855	H115Q	probably damaging	Het
Zpr1	T	A	9: 46,278,342	F340L	probably benign	Het

Other mutations in Abca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Abca1	APN	4	53059255	critical splice donor site	probably null
IGL00778:Abca1	APN	4	53086132	missense	probably benign
IGL01013:Abca1	APN	4	53038185	nonsense	probably null
IGL01510:Abca1	APN	4	53143979	missense	probably damaging	0.97
IGL01608:Abca1	APN	4	53038158	missense	probably damaging	1.00
IGL01845:Abca1	APN	4	53090297	missense	probably damaging	1.00
IGL02048:Abca1	APN	4	53069831	missense	probably damaging	1.00
IGL02249:Abca1	APN	4	53068739	nonsense	probably null
IGL02569:Abca1	APN	4	53034061	missense	probably damaging	1.00
IGL02622:Abca1	APN	4	53034046	missense	probably damaging	0.99
R6720_abca1_529	UTSW	4	53083733	missense	probably damaging	1.00
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0050:Abca1	UTSW	4	53069910	splice site	probably benign
R0107:Abca1	UTSW	4	53080834	missense	probably benign	0.00
R0127:Abca1	UTSW	4	53067155	missense	probably benign	0.00
R0178:Abca1	UTSW	4	53081953	missense	possibly damaging	0.89
R0207:Abca1	UTSW	4	53086039	missense	probably damaging	0.97
R0267:Abca1	UTSW	4	53046105	missense	probably damaging	1.00
R0269:Abca1	UTSW	4	53044228	missense	probably benign
R0586:Abca1	UTSW	4	53092860	missense	probably benign	0.00
R0587:Abca1	UTSW	4	53107035	missense	probably benign	0.00
R1403:Abca1	UTSW	4	53059253	splice site	probably benign
R1404:Abca1	UTSW	4	53059253	splice site	probably benign
R1405:Abca1	UTSW	4	53059253	splice site	probably benign
R1558:Abca1	UTSW	4	53092887	missense	probably null	0.00
R1655:Abca1	UTSW	4	53050964	missense	probably benign
R1662:Abca1	UTSW	4	53090251	splice site	probably null
R1769:Abca1	UTSW	4	53074325	missense	probably damaging	1.00
R1898:Abca1	UTSW	4	53071977	missense	probably benign	0.08
R1945:Abca1	UTSW	4	53061509	frame shift	probably null
R1966:Abca1	UTSW	4	53050409	missense	probably damaging	1.00
R2055:Abca1	UTSW	4	53069881	missense	probably benign
R2185:Abca1	UTSW	4	53089830	missense	probably benign	0.12
R2202:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2203:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2204:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R3056:Abca1	UTSW	4	53127626	missense	probably benign
R3849:Abca1	UTSW	4	53061481	splice site	probably benign
R3850:Abca1	UTSW	4	53061481	splice site	probably benign
R3906:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R3908:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R4050:Abca1	UTSW	4	53044144	missense	probably damaging	1.00
R4204:Abca1	UTSW	4	53090369	missense	probably benign	0.00
R4225:Abca1	UTSW	4	53085106	missense	possibly damaging	0.87
R4577:Abca1	UTSW	4	53062568	missense	possibly damaging	0.94
R5022:Abca1	UTSW	4	53041570	frame shift	probably null
R5168:Abca1	UTSW	4	53086070	missense	probably benign
R5363:Abca1	UTSW	4	53132963	missense	probably benign	0.00
R5439:Abca1	UTSW	4	53042381	missense	possibly damaging	0.55
R5604:Abca1	UTSW	4	53067168	splice site	probably null
R5614:Abca1	UTSW	4	53046132	missense	probably damaging	1.00
R5810:Abca1	UTSW	4	53079631	missense	probably benign
R6001:Abca1	UTSW	4	53075555	missense	possibly damaging	0.68
R6151:Abca1	UTSW	4	53085261	missense	probably benign
R6185:Abca1	UTSW	4	53078089	missense	probably benign	0.31
R6262:Abca1	UTSW	4	53092917	missense	probably benign	0.01
R6455:Abca1	UTSW	4	53042376	missense	probably damaging	0.98
R6472:Abca1	UTSW	4	53085991	critical splice donor site	probably null
R6564:Abca1	UTSW	4	53034031	missense	possibly damaging	0.85
R6720:Abca1	UTSW	4	53083733	missense	probably damaging	1.00
R6903:Abca1	UTSW	4	53143952	missense	probably benign	0.17
R6960:Abca1	UTSW	4	53072924	missense	probably benign	0.00
R7065:Abca1	UTSW	4	53074233	missense	probably damaging	0.98
R7142:Abca1	UTSW	4	53082050	missense	probably damaging	1.00
R7322:Abca1	UTSW	4	53067151	missense	probably damaging	0.97
R7520:Abca1	UTSW	4	53078114	missense	probably benign
R7547:Abca1	UTSW	4	53109269	missense	probably benign	0.02
R7793:Abca1	UTSW	4	53042367	missense	not run
R7863:Abca1	UTSW	4	53107179	missense	probably benign
R7877:Abca1	UTSW	4	53046135	missense	possibly damaging	0.55
R8010:Abca1	UTSW	4	53127600	missense	probably benign
R8058:Abca1	UTSW	4	53081954	missense	possibly damaging	0.60
R8181:Abca1	UTSW	4	53059303	missense	probably benign	0.21
R8471:Abca1	UTSW	4	53044187	missense	probably damaging	1.00
R8774:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8774-TAIL:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8806:Abca1	UTSW	4	53084520	missense	probably benign	0.17
R8841:Abca1	UTSW	4	53143925	splice site	probably benign
R9081:Abca1	UTSW	4	53109162	critical splice donor site	probably null
R9483:Abca1	UTSW	4	53060351	missense	probably benign	0.11
R9532:Abca1	UTSW	4	53109284	missense	probably benign
R9621:Abca1	UTSW	4	53092918	missense	probably benign	0.00
R9638:Abca1	UTSW	4	53092806	missense	probably damaging	0.96
RF005:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
RF024:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
X0023:Abca1	UTSW	4	53049038	missense	possibly damaging	0.91
Z1177:Abca1	UTSW	4	53079584	missense	probably benign	0.00
Z1177:Abca1	UTSW	4	53080799	missense	probably benign	0.01
Z1177:Abca1	UTSW	4	53086133	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GAAGACTCCTAGTGGCTTTCC -3'
(R):5'- CAGGCTCATCAACAAGTCCATG -3'

Sequencing Primer
(F):5'- AGTGGCTTTCCTTTCTTTTTCCTGAC -3'
(R):5'- CAACAAGTCCATGGAGCTGCTG -3'

Posted On

2016-05-10