Incidental Mutation 'R4979:Clspn'
ID 384661
Institutional Source Beutler Lab
Gene Symbol Clspn
Ensembl Gene ENSMUSG00000042489
Gene Name claspin
Synonyms C85083, E130314M08Rik
MMRRC Submission 042574-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4979 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126450728-126487696 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 126472179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 951 (P951Q)
Ref Sequence ENSEMBL: ENSMUSP00000045344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048391]
AlphaFold Q80YR7
Predicted Effect probably damaging
Transcript: ENSMUST00000048391
AA Change: P951Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: P951Q

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
coiled coil region 159 187 N/A INTRINSIC
low complexity region 214 230 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 477 490 N/A INTRINSIC
coiled coil region 599 626 N/A INTRINSIC
low complexity region 632 658 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 732 753 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 968 975 N/A INTRINSIC
coiled coil region 1001 1036 N/A INTRINSIC
low complexity region 1045 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126512
SMART Domains Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
low complexity region 108 147 N/A INTRINSIC
low complexity region 153 170 N/A INTRINSIC
low complexity region 221 242 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146944
Meta Mutation Damage Score 0.1286 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,220,643 (GRCm39) E381K probably damaging Het
Abca1 T C 4: 53,085,092 (GRCm39) probably null Het
Abca7 C T 10: 79,840,617 (GRCm39) Q870* probably null Het
Ambp C T 4: 63,070,888 (GRCm39) V64M probably benign Het
Ank1 T C 8: 23,622,212 (GRCm39) V1542A probably damaging Het
Anln T C 9: 22,287,797 (GRCm39) Y168C probably benign Het
Apoa4 T A 9: 46,152,803 (GRCm39) N29K probably benign Het
Arfgef1 T C 1: 10,283,334 (GRCm39) T192A probably damaging Het
Atad2b G T 12: 5,084,513 (GRCm39) D1420Y probably damaging Het
Baiap3 A G 17: 25,465,336 (GRCm39) W648R possibly damaging Het
Bank1 A G 3: 135,960,662 (GRCm39) L198P probably damaging Het
Bicd2 A G 13: 49,532,940 (GRCm39) K509E possibly damaging Het
Cacna1e T C 1: 154,289,739 (GRCm39) D1821G probably damaging Het
Ccdc80 G A 16: 44,936,650 (GRCm39) V692M possibly damaging Het
Ccdc88a C T 11: 29,432,133 (GRCm39) Q308* probably null Het
Ccl8 T C 11: 82,006,973 (GRCm39) V62A probably damaging Het
Cngb1 T A 8: 95,985,785 (GRCm39) I858F probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Ctc1 C T 11: 68,924,328 (GRCm39) A960V probably damaging Het
Ctnnd2 A G 15: 31,009,221 (GRCm39) E1106G probably damaging Het
Dido1 C T 2: 180,302,606 (GRCm39) R1766H probably damaging Het
Dipk1a A T 5: 108,057,400 (GRCm39) L386* probably null Het
Dnajc13 G T 9: 104,063,922 (GRCm39) N1341K probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
E2f8 G A 7: 48,524,918 (GRCm39) probably benign Het
Entpd8 A G 2: 24,972,967 (GRCm39) D91G possibly damaging Het
Fars2 A G 13: 36,388,564 (GRCm39) R18G possibly damaging Het
Fcgbp A G 7: 27,816,995 (GRCm39) S2486G probably benign Het
Fibin C T 2: 110,192,963 (GRCm39) D60N possibly damaging Het
Fpgs A G 2: 32,577,379 (GRCm39) probably benign Het
Galnt15 A G 14: 31,765,247 (GRCm39) D303G probably damaging Het
Gli3 C A 13: 15,899,049 (GRCm39) T812K possibly damaging Het
Gpbar1 G C 1: 74,318,404 (GRCm39) A216P probably benign Het
Grin2d A G 7: 45,507,357 (GRCm39) I448T probably benign Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Iqce G T 5: 140,677,376 (GRCm39) D148E probably damaging Het
Iqcg T A 16: 32,839,884 (GRCm39) E354V probably damaging Het
Iws1 T C 18: 32,226,320 (GRCm39) probably benign Het
Ly75 C T 2: 60,206,238 (GRCm39) G144S probably damaging Het
Marco C A 1: 120,421,954 (GRCm39) M83I probably benign Het
Mettl6 A T 14: 31,201,752 (GRCm39) L185H probably damaging Het
Mppe1 C T 18: 67,362,773 (GRCm39) G154D probably damaging Het
Mrpl42 T C 10: 95,326,237 (GRCm39) E85G probably benign Het
Neb A G 2: 52,079,921 (GRCm39) V5518A probably damaging Het
Or12d13 A T 17: 37,647,759 (GRCm39) F121L probably benign Het
Or52p1 T A 7: 104,267,812 (GRCm39) F317I probably null Het
Or5b105 A T 19: 13,080,053 (GRCm39) I199N probably damaging Het
Or7a42 T A 10: 78,791,766 (GRCm39) C242* probably null Het
Or7d10 G T 9: 19,831,655 (GRCm39) S50I probably benign Het
Perm1 A G 4: 156,302,034 (GRCm39) T193A probably benign Het
Prkd2 T A 7: 16,582,652 (GRCm39) C172S probably damaging Het
Prr23a3 T A 9: 98,747,431 (GRCm39) D128E possibly damaging Het
Prss28 A G 17: 25,528,711 (GRCm39) Y51C probably damaging Het
Psmb1 A T 17: 15,696,451 (GRCm39) M85K probably benign Het
Rae1 T A 2: 172,854,401 (GRCm39) probably benign Het
Rasal1 A G 5: 120,816,741 (GRCm39) D759G probably benign Het
Rcvrn G A 11: 67,586,246 (GRCm39) G2R probably damaging Het
Robo3 C T 9: 37,334,640 (GRCm39) A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,229,114 (GRCm39) probably benign Homo
Sdcbp T A 4: 6,378,980 (GRCm39) Y22* probably null Het
Sin3a T C 9: 57,025,360 (GRCm39) F1069L probably damaging Het
Slitrk3 C T 3: 72,957,129 (GRCm39) V548I possibly damaging Het
Tbc1d22a A G 15: 86,275,287 (GRCm39) H403R probably damaging Het
Tbr1 G T 2: 61,635,593 (GRCm39) probably null Het
Tiam2 T A 17: 3,555,985 (GRCm39) D65E probably damaging Het
Tpcn2 A G 7: 144,813,833 (GRCm39) S488P probably benign Het
Trav9-2 T C 14: 53,828,695 (GRCm39) S22P probably damaging Het
Trim34a T A 7: 103,897,069 (GRCm39) N44K probably benign Het
Unc79 C G 12: 103,078,691 (GRCm39) P1619A probably benign Het
Usp22 A T 11: 61,048,042 (GRCm39) V426E probably damaging Het
Vhl A T 6: 113,601,159 (GRCm39) M20L unknown Het
Vmn1r215 G A 13: 23,260,064 (GRCm39) A35T probably benign Het
Vmn1r222 G A 13: 23,416,602 (GRCm39) L204F possibly damaging Het
Zfp871 A T 17: 32,994,829 (GRCm39) H115Q probably damaging Het
Zpr1 T A 9: 46,189,640 (GRCm39) F340L probably benign Het
Other mutations in Clspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Clspn APN 4 126,466,971 (GRCm39) missense probably damaging 1.00
IGL02160:Clspn APN 4 126,475,303 (GRCm39) missense probably benign 0.21
IGL02231:Clspn APN 4 126,453,021 (GRCm39) missense probably damaging 0.98
IGL02281:Clspn APN 4 126,459,563 (GRCm39) missense possibly damaging 0.90
IGL02368:Clspn APN 4 126,459,900 (GRCm39) missense probably benign
IGL03149:Clspn APN 4 126,470,295 (GRCm39) splice site probably benign
Durch UTSW 4 126,474,755 (GRCm39) missense probably damaging 0.99
R0012:Clspn UTSW 4 126,458,722 (GRCm39) unclassified probably benign
R0035:Clspn UTSW 4 126,458,796 (GRCm39) splice site probably null
R0035:Clspn UTSW 4 126,458,796 (GRCm39) splice site probably null
R0207:Clspn UTSW 4 126,484,391 (GRCm39) missense possibly damaging 0.82
R0270:Clspn UTSW 4 126,467,029 (GRCm39) missense probably damaging 1.00
R0825:Clspn UTSW 4 126,466,923 (GRCm39) splice site probably benign
R1082:Clspn UTSW 4 126,471,572 (GRCm39) missense possibly damaging 0.95
R1349:Clspn UTSW 4 126,457,770 (GRCm39) missense probably benign
R1568:Clspn UTSW 4 126,475,310 (GRCm39) missense probably benign 0.01
R1649:Clspn UTSW 4 126,460,228 (GRCm39) unclassified probably benign
R1663:Clspn UTSW 4 126,459,768 (GRCm39) missense probably benign 0.00
R2497:Clspn UTSW 4 126,466,140 (GRCm39) missense possibly damaging 0.79
R3107:Clspn UTSW 4 126,485,452 (GRCm39) missense probably benign 0.06
R3951:Clspn UTSW 4 126,470,172 (GRCm39) missense probably damaging 1.00
R3953:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R3954:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R3956:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R4599:Clspn UTSW 4 126,475,253 (GRCm39) missense probably benign 0.14
R4717:Clspn UTSW 4 126,453,849 (GRCm39) missense probably damaging 1.00
R4853:Clspn UTSW 4 126,460,348 (GRCm39) missense probably damaging 0.99
R4854:Clspn UTSW 4 126,469,743 (GRCm39) missense probably benign
R5363:Clspn UTSW 4 126,455,579 (GRCm39) missense possibly damaging 0.58
R5531:Clspn UTSW 4 126,471,566 (GRCm39) missense probably benign
R5614:Clspn UTSW 4 126,474,755 (GRCm39) missense probably damaging 0.99
R5706:Clspn UTSW 4 126,472,211 (GRCm39) missense probably damaging 1.00
R5806:Clspn UTSW 4 126,479,899 (GRCm39) missense probably damaging 1.00
R6106:Clspn UTSW 4 126,484,434 (GRCm39) missense probably benign 0.00
R6178:Clspn UTSW 4 126,471,529 (GRCm39) splice site probably null
R6223:Clspn UTSW 4 126,479,961 (GRCm39) missense probably damaging 0.99
R6326:Clspn UTSW 4 126,459,532 (GRCm39) missense probably damaging 1.00
R6398:Clspn UTSW 4 126,457,740 (GRCm39) missense probably damaging 1.00
R6714:Clspn UTSW 4 126,459,561 (GRCm39) missense probably damaging 1.00
R7003:Clspn UTSW 4 126,486,513 (GRCm39) missense possibly damaging 0.63
R7034:Clspn UTSW 4 126,474,775 (GRCm39) missense possibly damaging 0.87
R7358:Clspn UTSW 4 126,459,993 (GRCm39) missense probably benign 0.02
R7376:Clspn UTSW 4 126,484,430 (GRCm39) missense possibly damaging 0.65
R7675:Clspn UTSW 4 126,460,113 (GRCm39) missense probably benign 0.00
R8320:Clspn UTSW 4 126,457,743 (GRCm39) missense possibly damaging 0.73
R8517:Clspn UTSW 4 126,460,012 (GRCm39) missense probably benign 0.00
R8547:Clspn UTSW 4 126,455,609 (GRCm39) missense probably damaging 1.00
R9106:Clspn UTSW 4 126,471,243 (GRCm39) intron probably benign
R9223:Clspn UTSW 4 126,484,411 (GRCm39) missense possibly damaging 0.60
R9361:Clspn UTSW 4 126,479,654 (GRCm39) missense probably damaging 0.99
R9527:Clspn UTSW 4 126,453,792 (GRCm39) nonsense probably null
R9717:Clspn UTSW 4 126,458,756 (GRCm39) missense possibly damaging 0.90
T0975:Clspn UTSW 4 126,460,230 (GRCm39) unclassified probably benign
X0014:Clspn UTSW 4 126,469,736 (GRCm39) missense probably damaging 1.00
Z1177:Clspn UTSW 4 126,459,970 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTGAACTTTTCCACATCCCAC -3'
(R):5'- GAACCGGATCCTAGGATTGC -3'

Sequencing Primer
(F):5'- CCACCTAAGAACTGAATTGAGCTGG -3'
(R):5'- AACCGGATCCTAGGATTGCTTAGTTG -3'
Posted On 2016-05-10