Mutagenetix > Incidental Mutation

Incidental Mutation 'R4979:Vhl'

384667

Institutional Source

Beutler Lab

Gene Symbol

Vhl

Ensembl Gene

ENSMUSG00000033933

Gene Name

von Hippel-Lindau tumor suppressor

Synonyms

Vhlh, pVHL

MMRRC Submission

042574-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4979 (G1)

Quality Score

139

Status

Validated

Chromosome

Chromosomal Location

113623959-113631633 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113624198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 20 (M20L)

Ref Sequence

ENSEMBL: ENSMUSP00000039418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035673]

AlphaFold

P40338

PDB Structure

SOLUTION STRUCTURE OF YEAST ELONGIN C IN COMPLEX WITH A VON HIPPEL-LINDAU PEPTIDE [SOLUTION NMR]

Predicted Effect

unknown
Transcript: ENSMUST00000035673
AA Change: M20L

SMART Domains

Protein: ENSMUSP00000039418
Gene: ENSMUSG00000033933
AA Change: M20L

Domain	Start	End	E-Value	Type
Pfam:VHL	27	172	3e-76	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128770

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131819

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus leads to defects similar to those seen in patients with von Hippel-Lindau disease. Abnormalities observed include hepatic and vasculature defects. Homozygozity for null mutations results in embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	A	17: 9,001,811	E381K	probably damaging	Het
Abca1	T	C	4: 53,085,092		probably null	Het
Abca7	C	T	10: 80,004,783	Q870*	probably null	Het
Ambp	C	T	4: 63,152,651	V64M	probably benign	Het
Ank1	T	C	8: 23,132,196	V1542A	probably damaging	Het
Anln	T	C	9: 22,376,501	Y168C	probably benign	Het
Apoa4	T	A	9: 46,241,505	N29K	probably benign	Het
Arfgef1	T	C	1: 10,213,109	T192A	probably damaging	Het
Atad2b	G	T	12: 5,034,513	D1420Y	probably damaging	Het
Baiap3	A	G	17: 25,246,362	W648R	possibly damaging	Het
Bank1	A	G	3: 136,254,901	L198P	probably damaging	Het
Bicd2	A	G	13: 49,379,464	K509E	possibly damaging	Het
Cacna1e	T	C	1: 154,413,993	D1821G	probably damaging	Het
Ccdc80	G	A	16: 45,116,287	V692M	possibly damaging	Het
Ccdc88a	C	T	11: 29,482,133	Q308*	probably null	Het
Ccl8	T	C	11: 82,116,147	V62A	probably damaging	Het
Clspn	C	A	4: 126,578,386	P951Q	probably damaging	Het
Cngb1	T	A	8: 95,259,157	I858F	probably damaging	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Ctc1	C	T	11: 69,033,502	A960V	probably damaging	Het
Ctnnd2	A	G	15: 31,009,075	E1106G	probably damaging	Het
Dido1	C	T	2: 180,660,813	R1766H	probably damaging	Het
Dnajc13	G	T	9: 104,186,723	N1341K	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
E2f8	G	A	7: 48,875,170		probably benign	Het
Entpd8	A	G	2: 25,082,955	D91G	possibly damaging	Het
Fam69a	A	T	5: 107,909,534	L386*	probably null	Het
Fars2	A	G	13: 36,204,581	R18G	possibly damaging	Het
Fcgbp	A	G	7: 28,117,570	S2486G	probably benign	Het
Fibin	C	T	2: 110,362,618	D60N	possibly damaging	Het
Fpgs	A	G	2: 32,687,367		probably benign	Het
Galnt15	A	G	14: 32,043,290	D303G	probably damaging	Het
Gli3	C	A	13: 15,724,464	T812K	possibly damaging	Het
Gpbar1	G	C	1: 74,279,245	A216P	probably benign	Het
Grin2d	A	G	7: 45,857,933	I448T	probably benign	Het
Il21	C	A	3: 37,232,504	S21I	probably damaging	Het
Iqce	G	T	5: 140,691,621	D148E	probably damaging	Het
Iqcg	T	A	16: 33,019,514	E354V	probably damaging	Het
Iws1	T	C	18: 32,093,267		probably benign	Het
Ly75	C	T	2: 60,375,894	G144S	probably damaging	Het
Marco	C	A	1: 120,494,225	M83I	probably benign	Het
Mettl6	A	T	14: 31,479,795	L185H	probably damaging	Het
Mppe1	C	T	18: 67,229,702	G154D	probably damaging	Het
Mrpl42	T	C	10: 95,490,375	E85G	probably benign	Het
Neb	A	G	2: 52,189,909	V5518A	probably damaging	Het
Olfr103	A	T	17: 37,336,868	F121L	probably benign	Het
Olfr1458	A	T	19: 13,102,689	I199N	probably damaging	Het
Olfr656	T	A	7: 104,618,605	F317I	probably null	Het
Olfr77	G	T	9: 19,920,359	S50I	probably benign	Het
Olfr8	T	A	10: 78,955,932	C242*	probably null	Het
Perm1	A	G	4: 156,217,577	T193A	probably benign	Het
Prkd2	T	A	7: 16,848,727	C172S	probably damaging	Het
Prr23a3	T	A	9: 98,865,378	D128E	possibly damaging	Het
Prss28	A	G	17: 25,309,737	Y51C	probably damaging	Het
Psmb1	A	T	17: 15,476,189	M85K	probably benign	Het
Rae1	T	A	2: 173,012,608		probably benign	Het
Rasal1	A	G	5: 120,678,676	D759G	probably benign	Het
Rcvrn	G	A	11: 67,695,420	G2R	probably damaging	Het
Robo3	C	T	9: 37,423,344	A597T	probably damaging	Het
Rsf1	GCG	GCGACGGCGCCG	7: 97,579,907		probably benign	Homo
Sdcbp	T	A	4: 6,378,980	Y22*	probably null	Het
Sin3a	T	C	9: 57,118,076	F1069L	probably damaging	Het
Slitrk3	C	T	3: 73,049,796	V548I	possibly damaging	Het
Tbc1d22a	A	G	15: 86,391,086	H403R	probably damaging	Het
Tbr1	G	T	2: 61,805,249		probably null	Het
Tiam2	T	A	17: 3,505,710	D65E	probably damaging	Het
Tpcn2	A	G	7: 145,260,096	S488P	probably benign	Het
Trav9-2	T	C	14: 53,591,238	S22P	probably damaging	Het
Trim34a	T	A	7: 104,247,862	N44K	probably benign	Het
Unc79	C	G	12: 103,112,432	P1619A	probably benign	Het
Usp22	A	T	11: 61,157,216	V426E	probably damaging	Het
Vmn1r215	G	A	13: 23,075,894	A35T	probably benign	Het
Vmn1r222	G	A	13: 23,232,432	L204F	possibly damaging	Het
Zfp871	A	T	17: 32,775,855	H115Q	probably damaging	Het
Zpr1	T	A	9: 46,278,342	F340L	probably benign	Het

Other mutations in Vhl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R3801:Vhl	UTSW	6	113629462	missense	probably benign	0.07
R5529:Vhl	UTSW	6	113629463	missense	probably benign	0.00
R7163:Vhl	UTSW	6	113629490	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GAGGTGGAATTTATAACCCGGG -3'
(R):5'- TACCTCGGTAGCTGTGGATG -3'

Sequencing Primer
(F):5'- TGGAATTTATAACCCGGGGCTCC -3'
(R):5'- TAGCTGTGGATGCGGCG -3'

Posted On

2016-05-10