Incidental Mutation 'R4979:Or52p1'
ID 384672
Institutional Source Beutler Lab
Gene Symbol Or52p1
Ensembl Gene ENSMUSG00000073924
Gene Name olfactory receptor family 52 subfamily P member 1
Synonyms MOR27-1, Olfr656, GA_x6K02T2PBJ9-7245486-7246451
MMRRC Submission 042574-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R4979 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 104266864-104267853 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104267812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 317 (F317I)
Ref Sequence ENSEMBL: ENSMUSP00000095774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098172] [ENSMUST00000215575]
AlphaFold Q8VGX9
Predicted Effect probably null
Transcript: ENSMUST00000098172
AA Change: F317I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095774
Gene: ENSMUSG00000073924
AA Change: F317I

DomainStartEndE-ValueType
Pfam:7tm_4 41 319 5.2e-105 PFAM
Pfam:7TM_GPCR_Srsx 42 316 1.1e-8 PFAM
Pfam:7tm_1 51 302 4.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210687
AA Change: F309I
Predicted Effect probably benign
Transcript: ENSMUST00000215575
AA Change: F309I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,220,643 (GRCm39) E381K probably damaging Het
Abca1 T C 4: 53,085,092 (GRCm39) probably null Het
Abca7 C T 10: 79,840,617 (GRCm39) Q870* probably null Het
Ambp C T 4: 63,070,888 (GRCm39) V64M probably benign Het
Ank1 T C 8: 23,622,212 (GRCm39) V1542A probably damaging Het
Anln T C 9: 22,287,797 (GRCm39) Y168C probably benign Het
Apoa4 T A 9: 46,152,803 (GRCm39) N29K probably benign Het
Arfgef1 T C 1: 10,283,334 (GRCm39) T192A probably damaging Het
Atad2b G T 12: 5,084,513 (GRCm39) D1420Y probably damaging Het
Baiap3 A G 17: 25,465,336 (GRCm39) W648R possibly damaging Het
Bank1 A G 3: 135,960,662 (GRCm39) L198P probably damaging Het
Bicd2 A G 13: 49,532,940 (GRCm39) K509E possibly damaging Het
Cacna1e T C 1: 154,289,739 (GRCm39) D1821G probably damaging Het
Ccdc80 G A 16: 44,936,650 (GRCm39) V692M possibly damaging Het
Ccdc88a C T 11: 29,432,133 (GRCm39) Q308* probably null Het
Ccl8 T C 11: 82,006,973 (GRCm39) V62A probably damaging Het
Clspn C A 4: 126,472,179 (GRCm39) P951Q probably damaging Het
Cngb1 T A 8: 95,985,785 (GRCm39) I858F probably damaging Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Ctc1 C T 11: 68,924,328 (GRCm39) A960V probably damaging Het
Ctnnd2 A G 15: 31,009,221 (GRCm39) E1106G probably damaging Het
Dido1 C T 2: 180,302,606 (GRCm39) R1766H probably damaging Het
Dipk1a A T 5: 108,057,400 (GRCm39) L386* probably null Het
Dnajc13 G T 9: 104,063,922 (GRCm39) N1341K probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
E2f8 G A 7: 48,524,918 (GRCm39) probably benign Het
Entpd8 A G 2: 24,972,967 (GRCm39) D91G possibly damaging Het
Fars2 A G 13: 36,388,564 (GRCm39) R18G possibly damaging Het
Fcgbp A G 7: 27,816,995 (GRCm39) S2486G probably benign Het
Fibin C T 2: 110,192,963 (GRCm39) D60N possibly damaging Het
Fpgs A G 2: 32,577,379 (GRCm39) probably benign Het
Galnt15 A G 14: 31,765,247 (GRCm39) D303G probably damaging Het
Gli3 C A 13: 15,899,049 (GRCm39) T812K possibly damaging Het
Gpbar1 G C 1: 74,318,404 (GRCm39) A216P probably benign Het
Grin2d A G 7: 45,507,357 (GRCm39) I448T probably benign Het
Il21 C A 3: 37,286,653 (GRCm39) S21I probably damaging Het
Iqce G T 5: 140,677,376 (GRCm39) D148E probably damaging Het
Iqcg T A 16: 32,839,884 (GRCm39) E354V probably damaging Het
Iws1 T C 18: 32,226,320 (GRCm39) probably benign Het
Ly75 C T 2: 60,206,238 (GRCm39) G144S probably damaging Het
Marco C A 1: 120,421,954 (GRCm39) M83I probably benign Het
Mettl6 A T 14: 31,201,752 (GRCm39) L185H probably damaging Het
Mppe1 C T 18: 67,362,773 (GRCm39) G154D probably damaging Het
Mrpl42 T C 10: 95,326,237 (GRCm39) E85G probably benign Het
Neb A G 2: 52,079,921 (GRCm39) V5518A probably damaging Het
Or12d13 A T 17: 37,647,759 (GRCm39) F121L probably benign Het
Or5b105 A T 19: 13,080,053 (GRCm39) I199N probably damaging Het
Or7a42 T A 10: 78,791,766 (GRCm39) C242* probably null Het
Or7d10 G T 9: 19,831,655 (GRCm39) S50I probably benign Het
Perm1 A G 4: 156,302,034 (GRCm39) T193A probably benign Het
Prkd2 T A 7: 16,582,652 (GRCm39) C172S probably damaging Het
Prr23a3 T A 9: 98,747,431 (GRCm39) D128E possibly damaging Het
Prss28 A G 17: 25,528,711 (GRCm39) Y51C probably damaging Het
Psmb1 A T 17: 15,696,451 (GRCm39) M85K probably benign Het
Rae1 T A 2: 172,854,401 (GRCm39) probably benign Het
Rasal1 A G 5: 120,816,741 (GRCm39) D759G probably benign Het
Rcvrn G A 11: 67,586,246 (GRCm39) G2R probably damaging Het
Robo3 C T 9: 37,334,640 (GRCm39) A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,229,114 (GRCm39) probably benign Homo
Sdcbp T A 4: 6,378,980 (GRCm39) Y22* probably null Het
Sin3a T C 9: 57,025,360 (GRCm39) F1069L probably damaging Het
Slitrk3 C T 3: 72,957,129 (GRCm39) V548I possibly damaging Het
Tbc1d22a A G 15: 86,275,287 (GRCm39) H403R probably damaging Het
Tbr1 G T 2: 61,635,593 (GRCm39) probably null Het
Tiam2 T A 17: 3,555,985 (GRCm39) D65E probably damaging Het
Tpcn2 A G 7: 144,813,833 (GRCm39) S488P probably benign Het
Trav9-2 T C 14: 53,828,695 (GRCm39) S22P probably damaging Het
Trim34a T A 7: 103,897,069 (GRCm39) N44K probably benign Het
Unc79 C G 12: 103,078,691 (GRCm39) P1619A probably benign Het
Usp22 A T 11: 61,048,042 (GRCm39) V426E probably damaging Het
Vhl A T 6: 113,601,159 (GRCm39) M20L unknown Het
Vmn1r215 G A 13: 23,260,064 (GRCm39) A35T probably benign Het
Vmn1r222 G A 13: 23,416,602 (GRCm39) L204F possibly damaging Het
Zfp871 A T 17: 32,994,829 (GRCm39) H115Q probably damaging Het
Zpr1 T A 9: 46,189,640 (GRCm39) F340L probably benign Het
Other mutations in Or52p1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Or52p1 APN 7 104,266,928 (GRCm39) missense probably damaging 0.98
IGL01908:Or52p1 APN 7 104,266,906 (GRCm39) missense probably damaging 1.00
IGL02695:Or52p1 APN 7 104,267,678 (GRCm39) missense probably damaging 1.00
IGL03055:Or52p1 UTSW 7 104,267,413 (GRCm39) missense probably damaging 1.00
R0128:Or52p1 UTSW 7 104,267,788 (GRCm39) missense probably damaging 1.00
R0184:Or52p1 UTSW 7 104,267,447 (GRCm39) missense probably damaging 1.00
R4674:Or52p1 UTSW 7 104,267,631 (GRCm39) nonsense probably null
R4675:Or52p1 UTSW 7 104,267,631 (GRCm39) nonsense probably null
R4723:Or52p1 UTSW 7 104,267,696 (GRCm39) missense possibly damaging 0.56
R6273:Or52p1 UTSW 7 104,267,102 (GRCm39) missense probably damaging 1.00
R6359:Or52p1 UTSW 7 104,267,510 (GRCm39) missense probably damaging 1.00
R6582:Or52p1 UTSW 7 104,267,648 (GRCm39) missense probably damaging 1.00
R6750:Or52p1 UTSW 7 104,267,320 (GRCm39) missense probably damaging 0.99
R7426:Or52p1 UTSW 7 104,267,059 (GRCm39) missense probably damaging 1.00
R7786:Or52p1 UTSW 7 104,266,925 (GRCm39) missense probably benign 0.02
R8068:Or52p1 UTSW 7 104,267,460 (GRCm39) nonsense probably null
R8324:Or52p1 UTSW 7 104,267,321 (GRCm39) missense probably benign 0.00
R8486:Or52p1 UTSW 7 104,267,069 (GRCm39) missense possibly damaging 0.47
R8828:Or52p1 UTSW 7 104,267,486 (GRCm39) missense probably damaging 1.00
R8933:Or52p1 UTSW 7 104,266,873 (GRCm39) missense probably benign 0.05
R8971:Or52p1 UTSW 7 104,267,467 (GRCm39) missense probably damaging 1.00
R9329:Or52p1 UTSW 7 104,267,705 (GRCm39) missense probably damaging 1.00
X0065:Or52p1 UTSW 7 104,266,965 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGACTCTCATCCCAGGAAG -3'
(R):5'- GAACAGAAGCTTTTCAGAGGATC -3'

Sequencing Primer
(F):5'- GTCCAAAGCCTTAGGTACCTGTG -3'
(R):5'- CAGAAGCTTTTCAGAGGATCTTATC -3'
Posted On 2016-05-10