Incidental Mutation 'R4979:Sin3a'
ID384681
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Nametranscriptional regulator, SIN3A (yeast)
SynonymsSin3, mSin3A
MMRRC Submission 042574-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4979 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57072040-57128366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57118076 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1069 (F1069L)
Ref Sequence ENSEMBL: ENSMUSP00000126601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]
Predicted Effect probably damaging
Transcript: ENSMUST00000049169
AA Change: F1069L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: F1069L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125333
Predicted Effect probably damaging
Transcript: ENSMUST00000167715
AA Change: F1069L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: F1069L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167963
Predicted Effect probably damaging
Transcript: ENSMUST00000168177
AA Change: F1069L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: F1069L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168502
AA Change: F1069L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: F1069L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168678
AA Change: F1069L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: F1069L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.1667 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,811 E381K probably damaging Het
Abca1 T C 4: 53,085,092 probably null Het
Abca7 C T 10: 80,004,783 Q870* probably null Het
Ambp C T 4: 63,152,651 V64M probably benign Het
Ank1 T C 8: 23,132,196 V1542A probably damaging Het
Anln T C 9: 22,376,501 Y168C probably benign Het
Apoa4 T A 9: 46,241,505 N29K probably benign Het
Arfgef1 T C 1: 10,213,109 T192A probably damaging Het
Atad2b G T 12: 5,034,513 D1420Y probably damaging Het
Baiap3 A G 17: 25,246,362 W648R possibly damaging Het
Bank1 A G 3: 136,254,901 L198P probably damaging Het
Bicd2 A G 13: 49,379,464 K509E possibly damaging Het
Cacna1e T C 1: 154,413,993 D1821G probably damaging Het
Ccdc80 G A 16: 45,116,287 V692M possibly damaging Het
Ccdc88a C T 11: 29,482,133 Q308* probably null Het
Ccl8 T C 11: 82,116,147 V62A probably damaging Het
Clspn C A 4: 126,578,386 P951Q probably damaging Het
Cngb1 T A 8: 95,259,157 I858F probably damaging Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Ctc1 C T 11: 69,033,502 A960V probably damaging Het
Ctnnd2 A G 15: 31,009,075 E1106G probably damaging Het
Dido1 C T 2: 180,660,813 R1766H probably damaging Het
Dnajc13 G T 9: 104,186,723 N1341K probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
E2f8 G A 7: 48,875,170 probably benign Het
Entpd8 A G 2: 25,082,955 D91G possibly damaging Het
Fam69a A T 5: 107,909,534 L386* probably null Het
Fars2 A G 13: 36,204,581 R18G possibly damaging Het
Fcgbp A G 7: 28,117,570 S2486G probably benign Het
Fibin C T 2: 110,362,618 D60N possibly damaging Het
Fpgs A G 2: 32,687,367 probably benign Het
Galnt15 A G 14: 32,043,290 D303G probably damaging Het
Gli3 C A 13: 15,724,464 T812K possibly damaging Het
Gpbar1 G C 1: 74,279,245 A216P probably benign Het
Grin2d A G 7: 45,857,933 I448T probably benign Het
Il21 C A 3: 37,232,504 S21I probably damaging Het
Iqce G T 5: 140,691,621 D148E probably damaging Het
Iqcg T A 16: 33,019,514 E354V probably damaging Het
Iws1 T C 18: 32,093,267 probably benign Het
Ly75 C T 2: 60,375,894 G144S probably damaging Het
Marco C A 1: 120,494,225 M83I probably benign Het
Mettl6 A T 14: 31,479,795 L185H probably damaging Het
Mppe1 C T 18: 67,229,702 G154D probably damaging Het
Mrpl42 T C 10: 95,490,375 E85G probably benign Het
Neb A G 2: 52,189,909 V5518A probably damaging Het
Olfr103 A T 17: 37,336,868 F121L probably benign Het
Olfr1458 A T 19: 13,102,689 I199N probably damaging Het
Olfr656 T A 7: 104,618,605 F317I probably null Het
Olfr77 G T 9: 19,920,359 S50I probably benign Het
Olfr8 T A 10: 78,955,932 C242* probably null Het
Perm1 A G 4: 156,217,577 T193A probably benign Het
Prkd2 T A 7: 16,848,727 C172S probably damaging Het
Prr23a3 T A 9: 98,865,378 D128E possibly damaging Het
Prss28 A G 17: 25,309,737 Y51C probably damaging Het
Psmb1 A T 17: 15,476,189 M85K probably benign Het
Rae1 T A 2: 173,012,608 probably benign Het
Rasal1 A G 5: 120,678,676 D759G probably benign Het
Rcvrn G A 11: 67,695,420 G2R probably damaging Het
Robo3 C T 9: 37,423,344 A597T probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Homo
Sdcbp T A 4: 6,378,980 Y22* probably null Het
Slitrk3 C T 3: 73,049,796 V548I possibly damaging Het
Tbc1d22a A G 15: 86,391,086 H403R probably damaging Het
Tbr1 G T 2: 61,805,249 probably null Het
Tiam2 T A 17: 3,505,710 D65E probably damaging Het
Tpcn2 A G 7: 145,260,096 S488P probably benign Het
Trav9-2 T C 14: 53,591,238 S22P probably damaging Het
Trim34a T A 7: 104,247,862 N44K probably benign Het
Unc79 C G 12: 103,112,432 P1619A probably benign Het
Usp22 A T 11: 61,157,216 V426E probably damaging Het
Vhl A T 6: 113,624,198 M20L unknown Het
Vmn1r215 G A 13: 23,075,894 A35T probably benign Het
Vmn1r222 G A 13: 23,232,432 L204F possibly damaging Het
Zfp871 A T 17: 32,775,855 H115Q probably damaging Het
Zpr1 T A 9: 46,278,342 F340L probably benign Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57097901 missense probably damaging 1.00
IGL00836:Sin3a APN 9 57107345 splice site probably null
IGL00913:Sin3a APN 9 57098118 missense probably benign 0.01
IGL01721:Sin3a APN 9 57095325 missense probably damaging 1.00
IGL01964:Sin3a APN 9 57107347 splice site probably benign
IGL02333:Sin3a APN 9 57107559 missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57107441 missense probably damaging 0.99
Delicate UTSW 9 57103929 missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57095255 intron probably benign
PIT4519001:Sin3a UTSW 9 57095456 missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57118253 intron probably benign
R0309:Sin3a UTSW 9 57110912 missense probably benign 0.00
R0511:Sin3a UTSW 9 57096895 nonsense probably null
R1205:Sin3a UTSW 9 57119175 missense probably damaging 1.00
R1365:Sin3a UTSW 9 57125203 nonsense probably null
R1496:Sin3a UTSW 9 57119158 missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57103997 splice site probably benign
R1958:Sin3a UTSW 9 57105609 missense probably damaging 1.00
R1993:Sin3a UTSW 9 57101199 missense probably damaging 1.00
R2037:Sin3a UTSW 9 57096825 missense probably benign 0.14
R2065:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R2079:Sin3a UTSW 9 57089523 missense probably benign
R2193:Sin3a UTSW 9 57117477 missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57096834 nonsense probably null
R3929:Sin3a UTSW 9 57118137 missense probably damaging 0.98
R4326:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4327:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4329:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4765:Sin3a UTSW 9 57096803 missense probably benign 0.14
R4806:Sin3a UTSW 9 57086742 missense probably damaging 0.99
R5018:Sin3a UTSW 9 57110891 missense probably benign 0.00
R5368:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57110988 missense probably benign 0.10
R5391:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5395:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5519:Sin3a UTSW 9 57118173 critical splice donor site probably null
R5927:Sin3a UTSW 9 57111111 missense probably damaging 1.00
R5987:Sin3a UTSW 9 57127200 missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57107540 missense probably damaging 1.00
R6161:Sin3a UTSW 9 57095424 missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57103929 missense probably damaging 1.00
R6374:Sin3a UTSW 9 57117481 missense probably benign
R6456:Sin3a UTSW 9 57113701 missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57117540 missense probably benign 0.02
R6900:Sin3a UTSW 9 57107574 missense probably damaging 1.00
R7051:Sin3a UTSW 9 57103934 missense probably damaging 1.00
R7081:Sin3a UTSW 9 57094471 missense probably null 1.00
R7285:Sin3a UTSW 9 57127299 missense possibly damaging 0.57
R7462:Sin3a UTSW 9 57095525 missense probably benign 0.00
R7538:Sin3a UTSW 9 57103926 missense possibly damaging 0.95
RF017:Sin3a UTSW 9 57127326 missense possibly damaging 0.90
X0026:Sin3a UTSW 9 57125192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCATCACCAGCTTTTCAGTAC -3'
(R):5'- CTGCGCTCTAAACATCCTGAC -3'

Sequencing Primer
(F):5'- ACCAGCTTTTCAGTACCTTTCATATC -3'
(R):5'- CACTGGCTGCTCTTTAGAGGAC -3'
Posted On2016-05-10