Mutagenetix > Incidental Mutations

Incidental Mutation 'R4979:Bicd2'

384699

Institutional Source

Beutler Lab

Gene Symbol

Bicd2

Ensembl Gene

ENSMUSG00000037933

Gene Name

BICD cargo adaptor 2

Synonyms

0610027D24Rik, 1110005D12Rik

MMRRC Submission

042574-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.725) question?

Stock #

R4979 (G1)

Quality Score

194

Status

Validated

Chromosome

Chromosomal Location

49341585-49387026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49379464 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 509 (K509E)

Ref Sequence

ENSEMBL: ENSMUSP00000105712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048544] [ENSMUST00000110084] [ENSMUST00000110085] [ENSMUST00000220723]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048544
AA Change: K509E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039394
Gene: ENSMUSG00000037933
AA Change: K509E

Domain	Start	End	E-Value	Type
internal_repeat_1	22	50	2.25e-5	PROSPERO
Pfam:BicD	83	797	N/A	PFAM
low complexity region	807	819	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110084
AA Change: K435E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105711
Gene: ENSMUSG00000037933
AA Change: K435E

Domain	Start	End	E-Value	Type
Pfam:BicD	9	723	N/A	PFAM
low complexity region	733	745	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110085
AA Change: K509E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105712
Gene: ENSMUSG00000037933
AA Change: K509E

Domain	Start	End	E-Value	Type
internal_repeat_1	22	50	1.16e-5	PROSPERO
Pfam:BicD	83	797	N/A	PFAM
low complexity region	807	819	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220723

Meta Mutation Damage Score

0.0862

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D and a member of the Bicoid family. It has been implicated in dynein-mediated, minus end-directed motility along microtubules. It has also been reported to be a phosphorylation target of NIMA related kinase 8. Two alternative splice variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show postnatal and premature death associated with progressive hydrocephalus, enlarged lateral ventricles, aqueductal stenosis, abnormal gait, disrupted laminar organization of the cerebral cortex and cerebellum, and impaired cerebellar granule cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	A	17: 9,001,811	E381K	probably damaging	Het
Abca1	T	C	4: 53,085,092		probably null	Het
Abca7	C	T	10: 80,004,783	Q870*	probably null	Het
Ambp	C	T	4: 63,152,651	V64M	probably benign	Het
Ank1	T	C	8: 23,132,196	V1542A	probably damaging	Het
Anln	T	C	9: 22,376,501	Y168C	probably benign	Het
Apoa4	T	A	9: 46,241,505	N29K	probably benign	Het
Arfgef1	T	C	1: 10,213,109	T192A	probably damaging	Het
Atad2b	G	T	12: 5,034,513	D1420Y	probably damaging	Het
Baiap3	A	G	17: 25,246,362	W648R	possibly damaging	Het
Bank1	A	G	3: 136,254,901	L198P	probably damaging	Het
Cacna1e	T	C	1: 154,413,993	D1821G	probably damaging	Het
Ccdc80	G	A	16: 45,116,287	V692M	possibly damaging	Het
Ccdc88a	C	T	11: 29,482,133	Q308*	probably null	Het
Ccl8	T	C	11: 82,116,147	V62A	probably damaging	Het
Clspn	C	A	4: 126,578,386	P951Q	probably damaging	Het
Cngb1	T	A	8: 95,259,157	I858F	probably damaging	Het
Cspp1	T	A	1: 10,126,463	N900K	probably damaging	Het
Ctc1	C	T	11: 69,033,502	A960V	probably damaging	Het
Ctnnd2	A	G	15: 31,009,075	E1106G	probably damaging	Het
Dido1	C	T	2: 180,660,813	R1766H	probably damaging	Het
Dnajc13	G	T	9: 104,186,723	N1341K	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
E2f8	G	A	7: 48,875,170		probably benign	Het
Entpd8	A	G	2: 25,082,955	D91G	possibly damaging	Het
Fam69a	A	T	5: 107,909,534	L386*	probably null	Het
Fars2	A	G	13: 36,204,581	R18G	possibly damaging	Het
Fcgbp	A	G	7: 28,117,570	S2486G	probably benign	Het
Fibin	C	T	2: 110,362,618	D60N	possibly damaging	Het
Fpgs	A	G	2: 32,687,367		probably benign	Het
Galnt15	A	G	14: 32,043,290	D303G	probably damaging	Het
Gli3	C	A	13: 15,724,464	T812K	possibly damaging	Het
Gpbar1	G	C	1: 74,279,245	A216P	probably benign	Het
Grin2d	A	G	7: 45,857,933	I448T	probably benign	Het
Il21	C	A	3: 37,232,504	S21I	probably damaging	Het
Iqce	G	T	5: 140,691,621	D148E	probably damaging	Het
Iqcg	T	A	16: 33,019,514	E354V	probably damaging	Het
Iws1	T	C	18: 32,093,267		probably benign	Het
Ly75	C	T	2: 60,375,894	G144S	probably damaging	Het
Marco	C	A	1: 120,494,225	M83I	probably benign	Het
Mettl6	A	T	14: 31,479,795	L185H	probably damaging	Het
Mppe1	C	T	18: 67,229,702	G154D	probably damaging	Het
Mrpl42	T	C	10: 95,490,375	E85G	probably benign	Het
Neb	A	G	2: 52,189,909	V5518A	probably damaging	Het
Olfr103	A	T	17: 37,336,868	F121L	probably benign	Het
Olfr1458	A	T	19: 13,102,689	I199N	probably damaging	Het
Olfr656	T	A	7: 104,618,605	F317I	probably null	Het
Olfr77	G	T	9: 19,920,359	S50I	probably benign	Het
Olfr8	T	A	10: 78,955,932	C242*	probably null	Het
Perm1	A	G	4: 156,217,577	T193A	probably benign	Het
Prkd2	T	A	7: 16,848,727	C172S	probably damaging	Het
Prr23a3	T	A	9: 98,865,378	D128E	possibly damaging	Het
Prss28	A	G	17: 25,309,737	Y51C	probably damaging	Het
Psmb1	A	T	17: 15,476,189	M85K	probably benign	Het
Rae1	T	A	2: 173,012,608		probably benign	Het
Rasal1	A	G	5: 120,678,676	D759G	probably benign	Het
Rcvrn	G	A	11: 67,695,420	G2R	probably damaging	Het
Robo3	C	T	9: 37,423,344	A597T	probably damaging	Het
Rsf1	GCG	GCGACGGCGCCG	7: 97,579,907		probably benign	Homo
Sdcbp	T	A	4: 6,378,980	Y22*	probably null	Het
Sin3a	T	C	9: 57,118,076	F1069L	probably damaging	Het
Slitrk3	C	T	3: 73,049,796	V548I	possibly damaging	Het
Tbc1d22a	A	G	15: 86,391,086	H403R	probably damaging	Het
Tbr1	G	T	2: 61,805,249		probably null	Het
Tiam2	T	A	17: 3,505,710	D65E	probably damaging	Het
Tpcn2	A	G	7: 145,260,096	S488P	probably benign	Het
Trav9-2	T	C	14: 53,591,238	S22P	probably damaging	Het
Trim34a	T	A	7: 104,247,862	N44K	probably benign	Het
Unc79	C	G	12: 103,112,432	P1619A	probably benign	Het
Usp22	A	T	11: 61,157,216	V426E	probably damaging	Het
Vhl	A	T	6: 113,624,198	M20L	unknown	Het
Vmn1r215	G	A	13: 23,075,894	A35T	probably benign	Het
Vmn1r222	G	A	13: 23,232,432	L204F	possibly damaging	Het
Zfp871	A	T	17: 32,775,855	H115Q	probably damaging	Het
Zpr1	T	A	9: 46,278,342	F340L	probably benign	Het

Other mutations in Bicd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Bicd2	APN	13	49378316	missense	probably damaging	1.00
IGL02029:Bicd2	APN	13	49369499	missense	probably damaging	1.00
IGL02052:Bicd2	APN	13	49379189	missense	possibly damaging	0.91
IGL02955:Bicd2	APN	13	49378215	missense	probably benign
IGL03033:Bicd2	APN	13	49379920	missense	probably benign	0.09
IGL03395:Bicd2	APN	13	49375258	missense	probably damaging	1.00
IGL02802:Bicd2	UTSW	13	49378328	missense	probably damaging	1.00
P0027:Bicd2	UTSW	13	49379651	missense	probably benign	0.05
R0052:Bicd2	UTSW	13	49375314	missense	probably damaging	1.00
R0052:Bicd2	UTSW	13	49375314	missense	probably damaging	1.00
R0393:Bicd2	UTSW	13	49379870	missense	probably damaging	1.00
R0718:Bicd2	UTSW	13	49377875	splice site	probably null
R0730:Bicd2	UTSW	13	49378241	missense	possibly damaging	0.77
R1716:Bicd2	UTSW	13	49378310	missense	probably benign
R2004:Bicd2	UTSW	13	49379405	missense	possibly damaging	0.50
R2041:Bicd2	UTSW	13	49341776	missense	probably benign	0.02
R2151:Bicd2	UTSW	13	49379576	missense	probably damaging	1.00
R2152:Bicd2	UTSW	13	49379576	missense	probably damaging	1.00
R2444:Bicd2	UTSW	13	49379024	missense	probably benign	0.00
R4085:Bicd2	UTSW	13	49384962	splice site	probably null
R4477:Bicd2	UTSW	13	49377972	missense	probably damaging	1.00
R4824:Bicd2	UTSW	13	49379012	missense	probably damaging	1.00
R6348:Bicd2	UTSW	13	49379846	missense	probably damaging	1.00
R7317:Bicd2	UTSW	13	49378308	missense	probably damaging	1.00
R7326:Bicd2	UTSW	13	49369609	missense	probably benign	0.43
R7395:Bicd2	UTSW	13	49378230	missense	possibly damaging	0.79
R7448:Bicd2	UTSW	13	49379951	missense	probably damaging	1.00
R7789:Bicd2	UTSW	13	49379659	missense	probably damaging	1.00
T0722:Bicd2	UTSW	13	49379651	missense	probably benign	0.05
X0003:Bicd2	UTSW	13	49379651	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATCAATGGGCCTGAGATCCTG -3'
(R):5'- AACTGGGTGAAGGACTGTTG -3'

Sequencing Primer
(F):5'- TGAGATCCTGGCCTGCAAGTAC -3'
(R):5'- CCCTTGGGCAAGAGGACAG -3'

Posted On

2016-05-10