Incidental Mutation 'R4980:Vangl2'
ID384722
Institutional Source Beutler Lab
Gene Symbol Vangl2
Ensembl Gene ENSMUSG00000026556
Gene NameVANGL planar cell polarity 2
SynonymsC530001F03Rik, Ltap, loop-tail, Lpp1, strabismus, ska, ska17
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172000960-172028444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 172009565 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 226 (L226I)
Ref Sequence ENSEMBL: ENSMUSP00000106895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027837] [ENSMUST00000111263] [ENSMUST00000111264] [ENSMUST00000138714] [ENSMUST00000153662]
Predicted Effect probably damaging
Transcript: ENSMUST00000027837
AA Change: L226I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027837
Gene: ENSMUSG00000026556
AA Change: L226I

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111263
AA Change: L226I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106894
Gene: ENSMUSG00000026556
AA Change: L226I

DomainStartEndE-ValueType
Pfam:Strabismus 22 521 3.1e-267 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111264
AA Change: L226I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106895
Gene: ENSMUSG00000026556
AA Change: L226I

DomainStartEndE-ValueType
Pfam:Strabismus 19 272 5e-115 PFAM
Pfam:Strabismus 298 560 1.3e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138714
SMART Domains Protein: ENSMUSP00000117736
Gene: ENSMUSG00000026556

DomainStartEndE-ValueType
Pfam:Strabismus 22 102 2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148363
Predicted Effect probably benign
Transcript: ENSMUST00000153662
SMART Domains Protein: ENSMUSP00000116522
Gene: ENSMUSG00000026556

DomainStartEndE-ValueType
Pfam:Strabismus 22 130 2.4e-38 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the regulation of planar cell polarity, especially in the stereociliary bundles of the cochlea. The encoded protein transmits directional signals to individual cells or groups of cells in epithelial sheets. This protein is also involved in the development of the neural plate. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous animals do not survive past birth. Developmental defects are seen in the nervous, cardiovascular, skeletal, vestibular, and respiratory systems. Kinked or looped tails are noted in heterozygotes with partial penetrance, along with a head wobble and some nervous system deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Vangl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Vangl2 APN 1 172012848 missense probably damaging 1.00
crimp UTSW 1 172006127 missense probably damaging 1.00
Piggy UTSW 1 172009663 missense possibly damaging 0.95
R0594:Vangl2 UTSW 1 172004657 missense probably damaging 1.00
R0718:Vangl2 UTSW 1 172006217 missense probably damaging 1.00
R1162:Vangl2 UTSW 1 172004847 missense probably damaging 1.00
R1173:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1174:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1175:Vangl2 UTSW 1 172004786 missense probably damaging 1.00
R1857:Vangl2 UTSW 1 172009897 missense probably damaging 0.99
R2290:Vangl2 UTSW 1 172008546 nonsense probably null
R2421:Vangl2 UTSW 1 172007959 missense probably damaging 1.00
R4024:Vangl2 UTSW 1 172008041 missense probably benign 0.00
R4809:Vangl2 UTSW 1 172009663 missense possibly damaging 0.95
R5761:Vangl2 UTSW 1 172006127 missense probably damaging 1.00
R8053:Vangl2 UTSW 1 172004736 missense probably damaging 1.00
R8297:Vangl2 UTSW 1 172009946 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACCTTTTCGGGTCTCATCTGG -3'
(R):5'- AGCTGCTCATCCTGCTGTTG -3'

Sequencing Primer
(F):5'- GGGTCTCATCTTTGTCCTACACCAAG -3'
(R):5'- GCAGCTGGGCTCTGTTC -3'
Posted On2016-05-10