Incidental Mutation 'R4980:Naa15'
ID384726
Institutional Source Beutler Lab
Gene Symbol Naa15
Ensembl Gene ENSMUSG00000063273
Gene NameN(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonymstubedown, ASTBDN, Tbdn-1, mNAT1, 5730450D16Rik, Narg1
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location51415148-51476507 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 51458752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029303] [ENSMUST00000193266]
Predicted Effect probably null
Transcript: ENSMUST00000029303
SMART Domains Protein: ENSMUSP00000029303
Gene: ENSMUSG00000063273

DomainStartEndE-ValueType
TPR 46 79 6.24e1 SMART
TPR 80 113 1.01e0 SMART
Blast:TPR 224 257 3e-12 BLAST
TPR 374 407 1.87e1 SMART
TPR 408 441 5.06e1 SMART
low complexity region 603 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192523
Predicted Effect probably null
Transcript: ENSMUST00000193266
SMART Domains Protein: ENSMUSP00000141433
Gene: ENSMUSG00000063273

DomainStartEndE-ValueType
Blast:TPR 1 29 3e-10 BLAST
TPR 30 63 4.9e-3 SMART
Blast:TPR 174 207 3e-12 BLAST
TPR 324 357 8.9e-2 SMART
TPR 358 391 2.4e-1 SMART
coiled coil region 533 585 N/A INTRINSIC
Blast:TPR 622 655 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194685
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes the auxillary subunit of the N-terminal acetyltransferase A (NatA) complex. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Naa15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Naa15 APN 3 51438405 missense probably damaging 1.00
IGL01753:Naa15 APN 3 51442853 missense probably damaging 1.00
IGL01837:Naa15 APN 3 51443948 nonsense probably null
IGL02619:Naa15 APN 3 51460131 missense probably benign 0.03
IGL02691:Naa15 APN 3 51451326 missense probably damaging 0.97
IGL02974:Naa15 APN 3 51461207 missense possibly damaging 0.95
R0009:Naa15 UTSW 3 51470219 missense probably damaging 1.00
R0010:Naa15 UTSW 3 51436213 critical splice acceptor site probably null
R0114:Naa15 UTSW 3 51448438 critical splice donor site probably null
R0411:Naa15 UTSW 3 51465639 missense possibly damaging 0.81
R1348:Naa15 UTSW 3 51465670 missense probably damaging 1.00
R1941:Naa15 UTSW 3 51455934 nonsense probably null
R3082:Naa15 UTSW 3 51460050 missense probably damaging 1.00
R4377:Naa15 UTSW 3 51448365 missense possibly damaging 0.91
R4591:Naa15 UTSW 3 51441924 missense probably damaging 1.00
R5087:Naa15 UTSW 3 51457285 splice site probably null
R5139:Naa15 UTSW 3 51443840 missense probably damaging 1.00
R5289:Naa15 UTSW 3 51455894 missense probably damaging 1.00
R5527:Naa15 UTSW 3 51441947 missense probably damaging 1.00
R5776:Naa15 UTSW 3 51460026 missense probably damaging 0.96
R5909:Naa15 UTSW 3 51460064 missense probably damaging 1.00
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6194:Naa15 UTSW 3 51463300 missense probably benign 0.00
R6291:Naa15 UTSW 3 51442791 missense probably damaging 1.00
R6522:Naa15 UTSW 3 51471514 missense probably damaging 1.00
R6731:Naa15 UTSW 3 51455873 missense probably damaging 1.00
R6984:Naa15 UTSW 3 51472600 missense probably benign 0.10
R7040:Naa15 UTSW 3 51472784 missense possibly damaging 0.89
R7091:Naa15 UTSW 3 51458756 splice site probably null
X0020:Naa15 UTSW 3 51470132 missense probably benign 0.00
X0061:Naa15 UTSW 3 51448600 missense probably damaging 1.00
X0061:Naa15 UTSW 3 51448601 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGACTTCTGATCAGTTGACCACTC -3'
(R):5'- GGAATGAGCAGCAGCAATTC -3'

Sequencing Primer
(F):5'- GATCAGTTGACCACTCTTCCC -3'
(R):5'- TGAGCAGCAGCAATTCAAAAATTC -3'
Posted On2016-05-10