Incidental Mutation 'R4980:Cdc14a'
ID384732
Institutional Source Beutler Lab
Gene Symbol Cdc14a
Ensembl Gene ENSMUSG00000033502
Gene NameCDC14 cell division cycle 14A
SynonymsCDC14A2, Cdc14, CDC14a1, A830059A17Rik
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116272553-116424032 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 116392857 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 92 (R92*)
Ref Sequence ENSEMBL: ENSMUSP00000102100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090464] [ENSMUST00000106491] [ENSMUST00000197830]
Predicted Effect probably null
Transcript: ENSMUST00000090464
AA Change: R92*
SMART Domains Protein: ENSMUSP00000087950
Gene: ENSMUSG00000033502
AA Change: R92*

DomainStartEndE-ValueType
Pfam:DSPn 13 153 1.6e-66 PFAM
Pfam:Y_phosphatase 210 324 1.1e-7 PFAM
Pfam:DSPc 214 328 1.8e-14 PFAM
low complexity region 539 558 N/A INTRINSIC
low complexity region 573 595 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106491
AA Change: R92*
SMART Domains Protein: ENSMUSP00000102100
Gene: ENSMUSG00000033502
AA Change: R92*

DomainStartEndE-ValueType
Pfam:DSPn 12 121 9.5e-44 PFAM
Pfam:Y_phosphatase 160 274 6.4e-8 PFAM
Pfam:DSPc 160 280 2.8e-14 PFAM
low complexity region 490 509 N/A INTRINSIC
low complexity region 524 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127704
Predicted Effect probably benign
Transcript: ENSMUST00000197830
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. It is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, suggesting a role in cell cycle control. This protein has been shown to interact with, and dephosphorylate tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splicing of this gene results in several transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Cdc14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cdc14a APN 3 116294844 nonsense probably null
IGL01062:Cdc14a APN 3 116274712 splice site probably benign
IGL01584:Cdc14a APN 3 116392825 nonsense probably null
IGL03084:Cdc14a APN 3 116348452 critical splice donor site probably null
IGL03237:Cdc14a APN 3 116404626 intron probably benign
IGL03296:Cdc14a APN 3 116297158 missense probably benign 0.02
PIT4131001:Cdc14a UTSW 3 116328661 missense possibly damaging 0.66
R0707:Cdc14a UTSW 3 116293713 splice site probably benign
R0782:Cdc14a UTSW 3 116322136 missense probably damaging 1.00
R0835:Cdc14a UTSW 3 116328522 missense probably benign 0.12
R1363:Cdc14a UTSW 3 116293860 small deletion probably benign
R1507:Cdc14a UTSW 3 116293997 missense possibly damaging 0.47
R1545:Cdc14a UTSW 3 116293724 critical splice donor site probably null
R1795:Cdc14a UTSW 3 116298473 missense possibly damaging 0.81
R1797:Cdc14a UTSW 3 116322194 missense probably damaging 1.00
R1830:Cdc14a UTSW 3 116422647 nonsense probably null
R4229:Cdc14a UTSW 3 116293764 missense probably damaging 0.99
R4655:Cdc14a UTSW 3 116328487 missense probably damaging 1.00
R4769:Cdc14a UTSW 3 116294750 critical splice donor site probably null
R4870:Cdc14a UTSW 3 116423460 missense probably benign 0.30
R6228:Cdc14a UTSW 3 116351213 missense probably damaging 1.00
R6248:Cdc14a UTSW 3 116308194 missense probably benign 0.01
R6402:Cdc14a UTSW 3 116348459 missense probably damaging 1.00
R6749:Cdc14a UTSW 3 116297158 missense possibly damaging 0.68
R6852:Cdc14a UTSW 3 116328676 missense possibly damaging 0.94
R6996:Cdc14a UTSW 3 116328706 missense probably damaging 1.00
R7185:Cdc14a UTSW 3 116294027 missense probably benign
R7783:Cdc14a UTSW 3 116404587 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCGATGATGTTAGTCCAC -3'
(R):5'- AAAGTGAGCAGTAGAACCCC -3'

Sequencing Primer
(F):5'- CGATGATGTTAGTCCACTTTACG -3'
(R):5'- GGAATGTCCCAAATACCAGAAGCTTG -3'
Posted On2016-05-10