Incidental Mutation 'R0347:Nipbl'
ID38476
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene NameNIPBL cohesin loading factor
Synonyms4921518A06Rik, 4933421G18Rik
MMRRC Submission 038554-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0347 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8290617-8444463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8350732 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 859 (S859P)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
Predicted Effect probably benign
Transcript: ENSMUST00000052965
AA Change: S859P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: S859P

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A T 10: 77,984,422 I209F probably damaging Het
5830411N06Rik T A 7: 140,297,854 H800Q probably damaging Het
Abca4 A G 3: 122,120,099 E908G probably benign Het
Abcb5 T A 12: 118,965,251 probably benign Het
Adhfe1 T A 1: 9,553,430 F102Y probably benign Het
Aff4 A G 11: 53,400,088 Y625C probably benign Het
Alox5 T C 6: 116,413,552 E488G possibly damaging Het
Ankmy2 T C 12: 36,193,754 C323R probably damaging Het
Ankrd28 A G 14: 31,702,022 *1084R probably null Het
Apol10a A T 15: 77,488,691 I176F probably damaging Het
Arhgap26 C T 18: 38,617,744 T70I unknown Het
Arid2 A G 15: 96,370,952 N982S probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camsap3 A G 8: 3,602,029 D291G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdc20b G T 13: 113,059,827 G162V probably damaging Het
Cep44 T G 8: 56,545,475 E56A probably damaging Het
Cfap65 A G 1: 74,926,444 L469P probably damaging Het
Cilp T A 9: 65,280,153 C1177S probably benign Het
Ctnnbip1 C T 4: 149,545,754 P7S probably damaging Het
Cyp11a1 T C 9: 58,016,260 probably benign Het
Cyp3a11 C T 5: 145,865,925 V253M possibly damaging Het
D630045J12Rik C A 6: 38,181,392 V1117L probably damaging Het
Dnah7b T A 1: 46,240,944 S2678T probably damaging Het
Dock1 T C 7: 134,763,867 I428T probably damaging Het
Fam83f A G 15: 80,672,257 D114G probably damaging Het
Flt3 T A 5: 147,357,992 N423I probably damaging Het
Fnbp1l A T 3: 122,590,175 F31L probably damaging Het
Glrx3 G A 7: 137,437,701 E10K unknown Het
Gm12185 T C 11: 48,915,182 E394G probably benign Het
Gm15448 A T 7: 3,822,874 V332E probably damaging Het
Gpatch1 C T 7: 35,297,631 V381M probably benign Het
Grm8 T C 6: 27,981,222 S230G probably benign Het
Heyl A T 4: 123,233,940 D25V probably benign Het
Junb G A 8: 84,978,478 probably benign Het
Klhl29 C A 12: 5,084,354 V747F probably damaging Het
Krt77 T C 15: 101,859,869 H569R unknown Het
Ldhb T C 6: 142,494,133 N227S probably benign Het
Megf6 A G 4: 154,254,635 D543G possibly damaging Het
Mrps23 A T 11: 88,210,693 Q136L probably benign Het
Myh2 C T 11: 67,185,304 probably benign Het
Nadk2 T A 15: 9,084,207 D133E probably benign Het
Neurod4 G A 10: 130,271,111 T98I probably damaging Het
Nfatc2 G T 2: 168,536,290 T465K probably damaging Het
Nipsnap3a T C 4: 52,997,155 probably benign Het
Nlrp4c A G 7: 6,066,416 K439E possibly damaging Het
Olfr1419 A T 19: 11,870,433 L261H probably damaging Het
Olfr392 C T 11: 73,814,311 G257D probably damaging Het
Olfr434 T C 6: 43,217,362 F150L probably benign Het
Pds5b T A 5: 150,736,427 probably benign Het
Plch1 A G 3: 63,753,316 M282T probably damaging Het
Plch2 C A 4: 154,986,721 R1067L possibly damaging Het
Pou2f2 A C 7: 25,097,701 F206V probably damaging Het
Prss50 A G 9: 110,862,350 I49V probably damaging Het
Rexo5 T A 7: 119,823,896 probably null Het
Rgl2 C T 17: 33,932,738 T252I probably damaging Het
Rp1l1 A T 14: 64,030,804 K1280* probably null Het
Rpl24 T A 16: 55,970,177 probably null Het
Satb1 T A 17: 51,739,906 K763* probably null Het
Sema6a T A 18: 47,291,129 R237S probably damaging Het
Spg11 T C 2: 122,097,369 T645A probably damaging Het
Srrt T A 5: 137,299,676 probably benign Het
Tanc1 T C 2: 59,842,991 V1480A probably benign Het
Tbc1d2 T C 4: 46,620,574 D412G possibly damaging Het
Tecrl T C 5: 83,294,632 E198G probably damaging Het
Tigd4 A G 3: 84,593,860 D28G probably damaging Het
Trp53bp2 T G 1: 182,441,648 L226V probably benign Het
Ttll13 T C 7: 80,260,505 S799P possibly damaging Het
Vps13c A T 9: 67,910,233 Q1062H possibly damaging Het
Wnt10a T G 1: 74,793,543 H98Q probably damaging Het
Zfp651 C T 9: 121,763,102 P198S probably damaging Het
Zfp959 T A 17: 55,897,180 Y69* probably null Het
Znrd1as T A 17: 36,965,315 M114K probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8360956 missense probably damaging 0.99
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0667:Nipbl UTSW 15 8361004 missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8327132 missense probably damaging 1.00
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2163:Nipbl UTSW 15 8336919 missense probably damaging 0.99
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
R7346:Nipbl UTSW 15 8343606 missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8330295 missense probably benign 0.01
R7486:Nipbl UTSW 15 8295636 missense probably benign 0.25
R7598:Nipbl UTSW 15 8343493 missense probably benign 0.24
R7609:Nipbl UTSW 15 8305872 missense probably benign 0.27
R7674:Nipbl UTSW 15 8293101 missense probably benign 0.15
R7706:Nipbl UTSW 15 8351526 missense probably benign 0.01
R7760:Nipbl UTSW 15 8358702 missense probably damaging 1.00
R7766:Nipbl UTSW 15 8296849 missense probably benign 0.45
R7825:Nipbl UTSW 15 8291487 missense probably damaging 1.00
R7862:Nipbl UTSW 15 8325752 missense probably benign 0.06
R7945:Nipbl UTSW 15 8325752 missense probably benign 0.06
RF020:Nipbl UTSW 15 8358934 missense probably damaging 0.98
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8338699 missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8336952 missense probably damaging 1.00
Z1177:Nipbl UTSW 15 8338680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGAACAACTACAGGCTTAGCTCC -3'
(R):5'- CTTAAAGCAGAGACCTGATGGGCG -3'

Sequencing Primer
(F):5'- GCTTGGAAATTCGGCCTTATTATCAG -3'
(R):5'- CGATGGGAGTCACTAAGACGTG -3'
Posted On2013-05-23