Incidental Mutation 'R4980:Wnt3a'
ID384760
Institutional Source Beutler Lab
Gene Symbol Wnt3a
Ensembl Gene ENSMUSG00000009900
Gene Namewingless-type MMTV integration site family, member 3A
SynonymsWnt-3a
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59248033-59290752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59249800 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 297 (C297S)
Ref Sequence ENSEMBL: ENSMUSP00000010044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010044]
Predicted Effect probably damaging
Transcript: ENSMUST00000010044
AA Change: C297S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010044
Gene: ENSMUSG00000009900
AA Change: C297S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
WNT1 44 352 9.57e-218 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 96% amino acid identity to mouse Wnt3A protein, and 84% to human WNT3 protein, another WNT gene product. This gene is clustered with WNT14 gene, another family member, in chromosome 1q42 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die at embryonic day 10.5-12.5 with failed development of caudal somites, notochord and structures rostral to hindlimbs. Homozygotes for a hypomorphic allele have vertebral defects and a short tail due to loss of caudal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Wnt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Wnt3a APN 11 59256309 missense probably benign 0.03
R0334:Wnt3a UTSW 11 59256318 missense probably damaging 0.97
R3912:Wnt3a UTSW 11 59250002 missense possibly damaging 0.91
R4041:Wnt3a UTSW 11 59249644 missense probably damaging 1.00
R5413:Wnt3a UTSW 11 59275356 missense probably benign 0.04
R5528:Wnt3a UTSW 11 59275280 missense probably damaging 0.99
R5626:Wnt3a UTSW 11 59290583 missense probably benign 0.17
R6355:Wnt3a UTSW 11 59275232 missense probably damaging 1.00
R6700:Wnt3a UTSW 11 59249761 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCTCCTACTTGCAGGTGTG -3'
(R):5'- CTGTGAAGTGAAGACCTGCTG -3'

Sequencing Primer
(F):5'- TGTGCACGTCATAGACACG -3'
(R):5'- ACCATCGGGGATTTCCTCAAG -3'
Posted On2016-05-10