Mutagenetix > Incidental Mutations

Incidental Mutation 'R4980:Ptprg'

384767

Institutional Source

Beutler Lab

Gene Symbol

Ptprg

Ensembl Gene

ENSMUSG00000021745

Gene Name

protein tyrosine phosphatase, receptor type, G

Synonyms

5430405N12Rik, RPTPgamma

MMRRC Submission

042575-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4980 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11553532-12242041 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12154421 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 714 (N714S)

Ref Sequence

ENSEMBL: ENSMUSP00000022264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000142917] [ENSMUST00000226099]

Predicted Effect

probably benign
Transcript: ENSMUST00000022264
AA Change: N714S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: N714S

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	321	6.38e-109	SMART
FN3	347	433	5.4e-7	SMART
low complexity region	474	484	N/A	INTRINSIC
low complexity region	515	525	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC
transmembrane domain	734	756	N/A	INTRINSIC
PTPc	844	1118	1.76e-136	SMART
PTPc	1146	1409	1.32e-85	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142917

SMART Domains

Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	260	1.6e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225204

Predicted Effect

unknown
Transcript: ENSMUST00000226099
AA Change: T147A

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,737,426	C189S	probably damaging	Het
4932438A13Rik	T	C	3: 36,943,312	S1173P	probably damaging	Het
9030624J02Rik	T	A	7: 118,807,009	D605E	probably damaging	Het
Abcd3	A	T	3: 121,769,268		probably null	Het
Adar	T	C	3: 89,730,814	S2P	probably benign	Het
Amhr2	T	A	15: 102,454,330	S511T	probably benign	Het
Atg16l1	T	C	1: 87,766,831	S77P	possibly damaging	Het
C530008M17Rik	A	T	5: 76,857,574	D594V	unknown	Het
Cacna1i	T	C	15: 80,348,449	F218L	probably damaging	Het
Cd5l	A	T	3: 87,367,601	H149L	probably benign	Het
Cdc14a	T	A	3: 116,392,857	R92*	probably null	Het
Col19a1	T	C	1: 24,526,483	T256A	unknown	Het
Col22a1	C	T	15: 71,801,943	A975T	unknown	Het
Cyp20a1	T	C	1: 60,363,214	W153R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Dpyd	T	C	3: 118,917,118	S392P	probably damaging	Het
Dst	A	T	1: 34,256,288	L957F	probably damaging	Het
Emilin2	G	T	17: 71,253,071	D970E	possibly damaging	Het
Fam208a	T	A	14: 27,461,425	L614I	probably benign	Het
Fbn2	T	C	18: 58,010,631	E2784G	probably benign	Het
Fbxw10	T	C	11: 62,847,757	I159T	possibly damaging	Het
Fgfr2	T	C	7: 130,201,080	Y192C	probably damaging	Het
Gm7298	A	G	6: 121,759,239		probably null	Het
Igf2r	C	T	17: 12,703,360		probably null	Het
Ints4	T	C	7: 97,501,850		probably null	Het
Kcnf1	A	G	12: 17,175,011	F403S	possibly damaging	Het
Kif11	C	T	19: 37,387,371	Q211*	probably null	Het
Kif13a	A	G	13: 46,752,746	S574P	possibly damaging	Het
Kifc3	T	A	8: 95,126,549	T60S	probably benign	Het
Krt82	T	C	15: 101,545,099	D284G	possibly damaging	Het
Lancl1	T	C	1: 67,004,809	Y344C	probably benign	Het
Ltbp3	A	T	19: 5,753,927		probably null	Het
Map3k4	A	G	17: 12,272,071	F158L	probably damaging	Het
Mast2	A	G	4: 116,317,751	Y469H	probably damaging	Het
Mcf2l	T	G	8: 12,984,883	F97C	probably damaging	Het
Mpeg1	T	C	19: 12,461,540	S121P	probably damaging	Het
Mycbp2	A	T	14: 103,260,385		probably null	Het
Myt1l	A	T	12: 29,827,039	T230S	unknown	Het
Naa15	T	C	3: 51,458,752		probably null	Het
Nans	G	A	4: 46,492,764	R64Q	probably benign	Het
Nbea	C	T	3: 55,647,351		probably null	Het
Nbea	T	C	3: 55,953,045	E1870G	probably benign	Het
Ncapd3	T	C	9: 27,063,295	S688P	probably damaging	Het
Nedd4l	G	T	18: 65,080,060	E96*	probably null	Het
Olfr1444	A	T	19: 12,862,020	M82L	probably benign	Het
Olfr683	T	A	7: 105,144,224	Y23F	probably benign	Het
Pdxk	A	G	10: 78,451,484	L81P	probably damaging	Het
Plec	T	A	15: 76,193,295	R269*	probably null	Het
Plec	T	C	15: 76,205,865	I92V	probably damaging	Het
Ppara	T	C	15: 85,787,233	Y112H	probably damaging	Het
Ppp2r2c	A	T	5: 36,952,388	M364L	probably benign	Het
Prag1	A	C	8: 36,139,586	H827P	probably damaging	Het
Rbp2	G	A	9: 98,498,841	V67I	probably benign	Het
Rictor	T	A	15: 6,781,660	Y835N	probably damaging	Het
Ripply2	A	G	9: 87,019,694	Q91R	probably damaging	Het
Sap130	C	A	18: 31,649,646	H203Q	possibly damaging	Het
Sema4d	T	C	13: 51,711,234	Y358C	probably damaging	Het
Serbp1	G	A	6: 67,277,888	D294N	probably benign	Het
Slc16a10	A	G	10: 40,080,805	W113R	probably damaging	Het
Slc6a6	A	G	6: 91,726,060	Y138C	probably damaging	Het
Spag11a	T	C	8: 19,157,946	M1T	probably null	Het
Spata20	T	C	11: 94,484,609	M120V	probably damaging	Het
Stk32a	A	C	18: 43,314,048	K357Q	probably benign	Het
Trmo	A	T	4: 46,389,364	C10*	probably null	Het
Tsc22d1	T	G	14: 76,418,256	V643G	probably benign	Het
Vangl2	A	T	1: 172,009,565	L226I	probably damaging	Het
Wnt3a	A	T	11: 59,249,800	C297S	probably damaging	Het
Wwc1	T	C	11: 35,888,103	K301E	possibly damaging	Het
Zfhx4	C	T	3: 5,398,979	T1399I	possibly damaging	Het
Zswim4	C	T	8: 84,226,667		probably null	Het

Other mutations in Ptprg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ptprg	APN	14	12215992	missense	probably damaging	1.00
IGL00484:Ptprg	APN	14	12215220	missense	probably damaging	0.99
IGL00847:Ptprg	APN	14	12215265	missense	probably damaging	1.00
IGL01089:Ptprg	APN	14	12215286	missense	probably damaging	0.97
IGL01382:Ptprg	APN	14	12237797	missense	probably benign	0.16
IGL01470:Ptprg	APN	14	12213702	nonsense	probably null
IGL01762:Ptprg	APN	14	12037386	missense	probably benign	0.00
IGL01886:Ptprg	APN	14	12179280	missense	probably benign	0.22
IGL01963:Ptprg	APN	14	12220661	missense	probably damaging	1.00
IGL02015:Ptprg	APN	14	12237782	missense	possibly damaging	0.46
IGL02086:Ptprg	APN	14	12110080	nonsense	probably null
IGL02197:Ptprg	APN	14	12220613	missense	probably damaging	0.98
IGL02341:Ptprg	APN	14	12154360	missense	probably benign	0.00
IGL02732:Ptprg	APN	14	12225617	critical splice donor site	probably null
IGL03011:Ptprg	APN	14	12219029	missense	probably damaging	1.00
IGL03261:Ptprg	APN	14	12225552	missense	probably damaging	0.99
R0038:Ptprg	UTSW	14	12213710	missense	probably damaging	1.00
R0383:Ptprg	UTSW	14	12219024	missense	possibly damaging	0.93
R0433:Ptprg	UTSW	14	12220620	missense	probably damaging	1.00
R0488:Ptprg	UTSW	14	12220653	missense	probably damaging	1.00
R0503:Ptprg	UTSW	14	12237138	missense	possibly damaging	0.89
R0520:Ptprg	UTSW	14	12199783	missense	possibly damaging	0.92
R0570:Ptprg	UTSW	14	12215896	missense	probably damaging	1.00
R0606:Ptprg	UTSW	14	12154131	missense	probably benign
R1086:Ptprg	UTSW	14	11952706	splice site	probably benign
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1519:Ptprg	UTSW	14	12220596	missense	probably damaging	1.00
R1662:Ptprg	UTSW	14	12207357	missense	probably damaging	1.00
R1714:Ptprg	UTSW	14	12213697	missense	probably damaging	1.00
R1716:Ptprg	UTSW	14	12154360	missense	probably benign	0.00
R1797:Ptprg	UTSW	14	12199743	missense	probably damaging	1.00
R1803:Ptprg	UTSW	14	12091410	splice site	probably null
R2104:Ptprg	UTSW	14	11952897	critical splice donor site	probably null
R2125:Ptprg	UTSW	14	12179283	missense	possibly damaging	0.74
R2126:Ptprg	UTSW	14	12154355	missense	probably benign
R2133:Ptprg	UTSW	14	12211637	missense	probably damaging	1.00
R2471:Ptprg	UTSW	14	12210327	missense	probably damaging	1.00
R2571:Ptprg	UTSW	14	12122135	missense	probably benign
R3821:Ptprg	UTSW	14	12226375	missense	probably benign	0.00
R4196:Ptprg	UTSW	14	12122002	missense	possibly damaging	0.51
R4392:Ptprg	UTSW	14	12142467	missense	possibly damaging	0.80
R4665:Ptprg	UTSW	14	12215288	missense	possibly damaging	0.90
R4730:Ptprg	UTSW	14	12213713	missense	probably damaging	1.00
R4737:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R4764:Ptprg	UTSW	14	12122068	missense	probably benign	0.01
R4801:Ptprg	UTSW	14	11554233	utr 5 prime	probably benign
R4825:Ptprg	UTSW	14	12220654	missense	probably damaging	1.00
R4960:Ptprg	UTSW	14	12237837	missense	probably benign	0.07
R4972:Ptprg	UTSW	14	12226427	missense	possibly damaging	0.94
R5004:Ptprg	UTSW	14	12220667	missense	probably damaging	1.00
R5058:Ptprg	UTSW	14	12037387	missense	possibly damaging	0.82
R5182:Ptprg	UTSW	14	12154174	missense	probably benign
R5258:Ptprg	UTSW	14	12142431	missense	probably benign	0.11
R5338:Ptprg	UTSW	14	12154111	missense	probably benign
R5353:Ptprg	UTSW	14	11554235	utr 5 prime	probably benign
R5373:Ptprg	UTSW	14	12213665	missense	probably benign	0.00
R5387:Ptprg	UTSW	14	12153873	missense	probably damaging	1.00
R5616:Ptprg	UTSW	14	12122120	missense	probably benign
R5623:Ptprg	UTSW	14	12153857	missense	probably damaging	1.00
R5976:Ptprg	UTSW	14	12211625	missense	probably damaging	0.96
R6027:Ptprg	UTSW	14	12220613	missense	possibly damaging	0.87
R6091:Ptprg	UTSW	14	12215979	missense	probably damaging	1.00
R6184:Ptprg	UTSW	14	12153943	missense	probably benign	0.00
R6234:Ptprg	UTSW	14	12213747	missense	probably damaging	1.00
R6318:Ptprg	UTSW	14	12237118	missense	probably damaging	1.00
R6324:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R6334:Ptprg	UTSW	14	12166832	missense	probably damaging	1.00
R6646:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6647:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6992:Ptprg	UTSW	14	11962602	missense	probably damaging	1.00
R7088:Ptprg	UTSW	14	12207365	missense	probably damaging	1.00
R7250:Ptprg	UTSW	14	12166767	missense	probably benign	0.18
R7342:Ptprg	UTSW	14	12237151	missense	possibly damaging	0.90
R7358:Ptprg	UTSW	14	12154198	missense	possibly damaging	0.59
R7410:Ptprg	UTSW	14	11962657	missense	probably damaging	1.00
R7448:Ptprg	UTSW	14	12142461	missense	probably benign	0.12
R7514:Ptprg	UTSW	14	12179342	missense	possibly damaging	0.86
R7523:Ptprg	UTSW	14	12237130	missense	probably damaging	0.97
R7672:Ptprg	UTSW	14	12211668	missense	probably benign	0.04
R7709:Ptprg	UTSW	14	12226452	missense	probably damaging	1.00
R7720:Ptprg	UTSW	14	12211703	missense	probably benign	0.31
X0020:Ptprg	UTSW	14	12110070	frame shift	probably null
X0027:Ptprg	UTSW	14	12110070	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACATCAGACTATACCTGGGCGC -3'
(R):5'- ATGCATCTCATTAGGGTGACAC -3'

Sequencing Primer
(F):5'- AGGCAGGACCACTCTGC -3'
(R):5'- CATCTCATTAGGGTGACACAAAAAG -3'

Posted On

2016-05-10