Incidental Mutation 'R4980:Nedd4l'
ID 384784
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 042575-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R4980 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 65213131 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 96 (E96*)
Ref Sequence ENSEMBL: ENSMUSP00000153537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000224385] [ENSMUST00000225057] [ENSMUST00000225261] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080418
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163516
AA Change: E96*
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: E96*

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223959
Predicted Effect probably benign
Transcript: ENSMUST00000224347
Predicted Effect probably benign
Transcript: ENSMUST00000224385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224516
Predicted Effect probably null
Transcript: ENSMUST00000225057
AA Change: E96*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224890
Predicted Effect probably benign
Transcript: ENSMUST00000225261
Predicted Effect probably benign
Transcript: ENSMUST00000226058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,885,292 (GRCm39) C189S probably damaging Het
Abcd3 A T 3: 121,562,917 (GRCm39) probably null Het
Adar T C 3: 89,638,121 (GRCm39) S2P probably benign Het
Amhr2 T A 15: 102,362,765 (GRCm39) S511T probably benign Het
Atg16l1 T C 1: 87,694,553 (GRCm39) S77P possibly damaging Het
Bltp1 T C 3: 36,997,461 (GRCm39) S1173P probably damaging Het
Cacna1i T C 15: 80,232,650 (GRCm39) F218L probably damaging Het
Cd5l A T 3: 87,274,908 (GRCm39) H149L probably benign Het
Cdc14a T A 3: 116,186,506 (GRCm39) R92* probably null Het
Col19a1 T C 1: 24,565,564 (GRCm39) T256A unknown Het
Col22a1 C T 15: 71,673,792 (GRCm39) A975T unknown Het
Cracd A T 5: 77,005,421 (GRCm39) D594V unknown Het
Cyp20a1 T C 1: 60,402,373 (GRCm39) W153R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dpyd T C 3: 118,710,767 (GRCm39) S392P probably damaging Het
Dst A T 1: 34,295,369 (GRCm39) L957F probably damaging Het
Emilin2 G T 17: 71,560,066 (GRCm39) D970E possibly damaging Het
Fbn2 T C 18: 58,143,703 (GRCm39) E2784G probably benign Het
Fbxw10 T C 11: 62,738,583 (GRCm39) I159T possibly damaging Het
Fgfr2 T C 7: 129,802,810 (GRCm39) Y192C probably damaging Het
Gm7298 A G 6: 121,736,198 (GRCm39) probably null Het
Igf2r C T 17: 12,922,247 (GRCm39) probably null Het
Ints4 T C 7: 97,151,057 (GRCm39) probably null Het
Kcnf1 A G 12: 17,225,012 (GRCm39) F403S possibly damaging Het
Kif11 C T 19: 37,375,819 (GRCm39) Q211* probably null Het
Kif13a A G 13: 46,906,222 (GRCm39) S574P possibly damaging Het
Kifc3 T A 8: 95,853,177 (GRCm39) T60S probably benign Het
Krt82 T C 15: 101,453,534 (GRCm39) D284G possibly damaging Het
Lancl1 T C 1: 67,043,968 (GRCm39) Y344C probably benign Het
Ltbp3 A T 19: 5,803,955 (GRCm39) probably null Het
Map3k4 A G 17: 12,490,958 (GRCm39) F158L probably damaging Het
Mast2 A G 4: 116,174,948 (GRCm39) Y469H probably damaging Het
Mcf2l T G 8: 13,034,883 (GRCm39) F97C probably damaging Het
Mpeg1 T C 19: 12,438,904 (GRCm39) S121P probably damaging Het
Mycbp2 A T 14: 103,497,821 (GRCm39) probably null Het
Myt1l A T 12: 29,877,038 (GRCm39) T230S unknown Het
Naa15 T C 3: 51,366,173 (GRCm39) probably null Het
Nans G A 4: 46,492,764 (GRCm39) R64Q probably benign Het
Nbea C T 3: 55,554,772 (GRCm39) probably null Het
Nbea T C 3: 55,860,466 (GRCm39) E1870G probably benign Het
Ncapd3 T C 9: 26,974,591 (GRCm39) S688P probably damaging Het
Or56a5 T A 7: 104,793,431 (GRCm39) Y23F probably benign Het
Or5b21 A T 19: 12,839,384 (GRCm39) M82L probably benign Het
Pdxk A G 10: 78,287,318 (GRCm39) L81P probably damaging Het
Plec T A 15: 76,077,495 (GRCm39) R269* probably null Het
Plec T C 15: 76,090,065 (GRCm39) I92V probably damaging Het
Ppara T C 15: 85,671,434 (GRCm39) Y112H probably damaging Het
Ppp2r2c A T 5: 37,109,732 (GRCm39) M364L probably benign Het
Prag1 A C 8: 36,606,740 (GRCm39) H827P probably damaging Het
Ptprg A G 14: 12,154,421 (GRCm38) N714S probably benign Het
Rbp2 G A 9: 98,380,894 (GRCm39) V67I probably benign Het
Rictor T A 15: 6,811,141 (GRCm39) Y835N probably damaging Het
Ripply2 A G 9: 86,901,747 (GRCm39) Q91R probably damaging Het
Sap130 C A 18: 31,782,699 (GRCm39) H203Q possibly damaging Het
Sema4d T C 13: 51,865,270 (GRCm39) Y358C probably damaging Het
Serbp1 G A 6: 67,254,872 (GRCm39) D294N probably benign Het
Slc16a10 A G 10: 39,956,801 (GRCm39) W113R probably damaging Het
Slc6a6 A G 6: 91,703,041 (GRCm39) Y138C probably damaging Het
Spag11a T C 8: 19,207,962 (GRCm39) M1T probably null Het
Spata20 T C 11: 94,375,435 (GRCm39) M120V probably damaging Het
Stk32a A C 18: 43,447,113 (GRCm39) K357Q probably benign Het
Tasor T A 14: 27,183,382 (GRCm39) L614I probably benign Het
Trmo A T 4: 46,389,364 (GRCm39) C10* probably null Het
Tsc22d1 T G 14: 76,655,696 (GRCm39) V643G probably benign Het
Vangl2 A T 1: 171,837,132 (GRCm39) L226I probably damaging Het
Vps35l T A 7: 118,406,232 (GRCm39) D605E probably damaging Het
Wnt3a A T 11: 59,140,626 (GRCm39) C297S probably damaging Het
Wwc1 T C 11: 35,778,930 (GRCm39) K301E possibly damaging Het
Zfhx4 C T 3: 5,464,039 (GRCm39) T1399I possibly damaging Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGATATTAGGGTAGAATAACAGC -3'
(R):5'- AAAGCATCTGGGGTGAGGTC -3'

Sequencing Primer
(F):5'- TAGGGTAGAATAACAGCATACAAGTC -3'
(R):5'- TCAATTTTCTGACCTAGCAACAC -3'
Posted On 2016-05-10