Incidental Mutation 'R4980:Nedd4l'
ID384784
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 65080060 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 96 (E96*)
Ref Sequence ENSEMBL: ENSMUSP00000153537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000224385] [ENSMUST00000225057] [ENSMUST00000225261] [ENSMUST00000226058]
Predicted Effect probably benign
Transcript: ENSMUST00000080418
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163516
AA Change: E96*
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: E96*

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223959
Predicted Effect probably benign
Transcript: ENSMUST00000224347
Predicted Effect probably benign
Transcript: ENSMUST00000224385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224890
Predicted Effect probably null
Transcript: ENSMUST00000225057
AA Change: E96*
Predicted Effect probably benign
Transcript: ENSMUST00000225261
Predicted Effect probably benign
Transcript: ENSMUST00000226058
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCCAGATATTAGGGTAGAATAACAGC -3'
(R):5'- AAAGCATCTGGGGTGAGGTC -3'

Sequencing Primer
(F):5'- TAGGGTAGAATAACAGCATACAAGTC -3'
(R):5'- TCAATTTTCTGACCTAGCAACAC -3'
Posted On2016-05-10