Incidental Mutation 'R4981:Aspm'
ID384793
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Nameabnormal spindle microtubule assembly
SynonymsAspm, Sha1, MCPH5, D330028K02Rik, Calmbp1
MMRRC Submission 042576-MU
Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4981 (G1)
Quality Score161
Status Validated
Chromosome1
Chromosomal Location139454772-139494091 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to C at 139470760 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
Predicted Effect probably null
Transcript: ENSMUST00000053364
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952

DomainStartEndE-ValueType
Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199998
Predicted Effect probably null
Transcript: ENSMUST00000200083
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

DomainStartEndE-ValueType
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (105/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,048,987 probably null Het
Aatf T C 11: 84,511,497 D121G probably benign Het
Amer2 T A 14: 60,379,727 L331H probably damaging Het
Ang4 T G 14: 51,764,372 K40Q probably benign Het
Cacna1c A T 6: 118,751,471 D337E probably benign Het
Ccdc124 T C 8: 70,868,785 E134G probably benign Het
Ccdc7a G T 8: 128,984,983 A312E probably benign Het
Ccdc84 A T 9: 44,417,948 F14Y probably damaging Het
Cd209g A G 8: 4,136,845 D130G probably damaging Het
Cd320 T C 17: 33,847,575 S96P probably benign Het
Clu C G 14: 65,973,366 Q134E probably damaging Het
Cnksr3 T A 10: 7,160,777 H28L probably benign Het
Cntnap1 T C 11: 101,176,333 probably null Het
Col22a1 C T 15: 71,861,066 C546Y unknown Het
Col6a3 C T 1: 90,778,843 V2183I unknown Het
Cop1 A G 1: 159,325,068 probably benign Het
Cpne8 T C 15: 90,679,235 I24V probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Dennd5b G A 6: 149,009,772 L978F possibly damaging Het
Depdc1a G T 3: 159,523,913 M627I probably benign Het
Dnah3 A T 7: 119,956,201 N2721K probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg1b A G 18: 20,408,868 T811A possibly damaging Het
Emilin1 C G 5: 30,919,351 Q847E probably benign Het
Epha3 A T 16: 63,652,412 V370D probably benign Het
Epha5 T A 5: 84,150,483 T406S probably damaging Het
Ephb1 A T 9: 102,040,960 I450N probably benign Het
Ephb2 A G 4: 136,696,010 M319T probably benign Het
Eps15l1 A G 8: 72,378,989 probably null Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fgd5 T C 6: 91,989,300 I838T probably damaging Het
Fnbp4 T C 2: 90,765,830 F582L probably damaging Het
Frs3 T C 17: 47,689,262 probably null Het
Fscb C T 12: 64,473,619 V358I possibly damaging Het
Fus G T 7: 127,967,555 probably benign Het
Fyb CCTCTCTCTCTCTCTCTCTCT CCTCTCTCTCTCTCTCTCT 15: 6,646,611 probably benign Het
Glra3 A T 8: 55,991,235 I77F possibly damaging Het
Gm4454 C T 7: 38,570,436 noncoding transcript Het
Gng3 G A 19: 8,838,261 A37V possibly damaging Het
Grin3b T A 10: 79,976,357 probably benign Het
Herpud1 A G 8: 94,391,794 Y41C probably damaging Het
Igkv4-92 G C 6: 68,755,044 S115R possibly damaging Het
Ikbip T A 10: 91,095,986 I164N probably benign Het
Kank1 A G 19: 25,411,395 T783A probably benign Het
Kcnq3 A T 15: 66,031,405 V152E possibly damaging Het
Kif23 C T 9: 61,931,871 R314H probably damaging Het
Klc4 T C 17: 46,644,361 H49R probably benign Het
Klhl20 A T 1: 161,103,005 I309N possibly damaging Het
Lgals4 A G 7: 28,841,276 Y268C probably damaging Het
Lingo4 A G 3: 94,399,454 Q13R probably benign Het
Lmtk2 C A 5: 144,176,447 F1328L probably damaging Het
Mapk14 A G 17: 28,741,791 R179G probably damaging Het
Mbd3l1 A T 9: 18,484,905 T109S probably benign Het
Megf6 T C 4: 154,267,450 F1169L possibly damaging Het
Mrgpra1 A T 7: 47,335,211 V240D probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myh1 T C 11: 67,224,474 probably benign Het
Nav3 T C 10: 109,880,692 I172V probably benign Het
Nemp1 T A 10: 127,693,530 L178Q probably damaging Het
Numa1 T C 7: 101,992,674 S110P probably damaging Het
Olfr1076 T C 2: 86,508,827 Y123H probably damaging Het
Olfr1222 T C 2: 89,125,501 T77A probably benign Het
Olfr1248 A G 2: 89,617,425 Y256H probably damaging Het
Olfr1500 A T 19: 13,828,094 F101I probably damaging Het
Olfr639 A G 7: 104,012,105 I199T probably damaging Het
Olfr995 A G 2: 85,438,469 S230P probably damaging Het
Pard3b T G 1: 62,344,060 M771R probably damaging Het
Phkg2 A G 7: 127,582,379 I245V probably damaging Het
Pik3cg A T 12: 32,204,104 M628K possibly damaging Het
Poln A G 5: 34,107,085 probably null Het
Ppip5k1 A T 2: 121,312,390 S1172T probably damaging Het
Prdm5 A T 6: 65,870,462 H363L probably damaging Het
Prkdc A G 16: 15,678,309 Y788C probably damaging Het
Prrc2c T A 1: 162,692,547 R2076S probably damaging Het
Sh2d2a A G 3: 87,849,421 Y191C probably damaging Het
Slc20a1 T C 2: 129,199,999 I94T probably damaging Het
Sptbn2 T C 19: 4,751,658 V2366A probably benign Het
Stab2 T A 10: 86,960,223 M387L probably benign Het
Syne2 T G 12: 75,941,219 M1718R probably damaging Het
Synm G T 7: 67,734,487 F700L probably benign Het
Tmco4 T C 4: 138,990,701 F51L possibly damaging Het
Tmem104 C A 11: 115,205,136 P168T probably damaging Het
Tril G T 6: 53,818,920 T439K probably benign Het
Trim2 A G 3: 84,177,735 L559P probably damaging Het
Trim3 A G 7: 105,619,128 V149A probably damaging Het
Triml2 A G 8: 43,187,680 N191S probably benign Het
Usp4 A G 9: 108,381,418 D16G probably benign Het
Vmn2r58 G A 7: 41,837,461 T670I probably damaging Het
Vmn2r97 G T 17: 18,940,174 G524* probably null Het
Xpo5 C A 17: 46,220,817 F426L probably damaging Het
Zfp800 A G 6: 28,247,191 L84S probably damaging Het
Zranb2 T G 3: 157,546,741 probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139478691 missense probably damaging 1.00
IGL00594:Aspm APN 1 139487422 splice site probably benign
IGL00808:Aspm APN 1 139461476 missense probably benign 0.03
IGL00897:Aspm APN 1 139477407 missense probably damaging 0.98
IGL01024:Aspm APN 1 139478124 missense possibly damaging 0.66
IGL01410:Aspm APN 1 139482444 missense probably benign 0.25
IGL01588:Aspm APN 1 139478162 missense probably benign 0.11
IGL01610:Aspm APN 1 139489670 nonsense probably null
IGL01633:Aspm APN 1 139480836 missense possibly damaging 0.93
IGL01982:Aspm APN 1 139491588 missense probably benign 0.12
IGL02429:Aspm APN 1 139479810 missense probably benign 0.27
IGL02468:Aspm APN 1 139480950 missense probably damaging 1.00
IGL02519:Aspm APN 1 139461927 splice site probably benign
IGL02526:Aspm APN 1 139489719 missense probably benign 0.03
IGL02716:Aspm APN 1 139479687 missense probably damaging 1.00
IGL02876:Aspm APN 1 139473653 missense probably damaging 1.00
IGL02953:Aspm APN 1 139457419 missense probably benign 0.01
IGL03275:Aspm APN 1 139487295 missense probably damaging 1.00
Stemware UTSW 1 139477459 nonsense probably null
3-1:Aspm UTSW 1 139457541 missense probably benign
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0140:Aspm UTSW 1 139480641 missense probably benign 0.00
R0195:Aspm UTSW 1 139479135 missense probably damaging 1.00
R0217:Aspm UTSW 1 139457880 missense possibly damaging 0.46
R0276:Aspm UTSW 1 139478471 missense possibly damaging 0.95
R0309:Aspm UTSW 1 139482511 splice site probably benign
R0466:Aspm UTSW 1 139477901 missense probably damaging 1.00
R0520:Aspm UTSW 1 139478820 missense possibly damaging 0.51
R0615:Aspm UTSW 1 139487289 missense probably damaging 1.00
R0626:Aspm UTSW 1 139491601 missense probably damaging 1.00
R0660:Aspm UTSW 1 139457764 missense probably benign 0.03
R0751:Aspm UTSW 1 139456898 splice site probably benign
R0830:Aspm UTSW 1 139474254 missense probably damaging 0.99
R1109:Aspm UTSW 1 139456758 missense probably damaging 0.99
R1114:Aspm UTSW 1 139461924 splice site probably benign
R1130:Aspm UTSW 1 139477834 missense possibly damaging 0.90
R1298:Aspm UTSW 1 139457419 missense probably benign 0.01
R1386:Aspm UTSW 1 139457623 missense probably benign 0.03
R1386:Aspm UTSW 1 139478972 missense possibly damaging 0.80
R1557:Aspm UTSW 1 139468668 missense probably benign 0.01
R1625:Aspm UTSW 1 139481039 missense probably benign 0.01
R1728:Aspm UTSW 1 139473574 missense probably benign
R1729:Aspm UTSW 1 139473574 missense probably benign
R1730:Aspm UTSW 1 139473574 missense probably benign
R1733:Aspm UTSW 1 139457117 missense probably benign 0.27
R1739:Aspm UTSW 1 139473574 missense probably benign
R1762:Aspm UTSW 1 139473574 missense probably benign
R1783:Aspm UTSW 1 139473574 missense probably benign
R1784:Aspm UTSW 1 139473574 missense probably benign
R1785:Aspm UTSW 1 139473574 missense probably benign
R1793:Aspm UTSW 1 139457341 missense probably benign 0.00
R1893:Aspm UTSW 1 139479867 missense probably damaging 1.00
R1911:Aspm UTSW 1 139478094 missense probably benign 0.06
R2103:Aspm UTSW 1 139491665 missense probably damaging 0.99
R2128:Aspm UTSW 1 139457635 missense probably benign 0.14
R2129:Aspm UTSW 1 139457635 missense probably benign 0.14
R2239:Aspm UTSW 1 139456846 missense possibly damaging 0.67
R2352:Aspm UTSW 1 139457562 missense probably benign 0.02
R2353:Aspm UTSW 1 139477697 missense probably damaging 1.00
R2380:Aspm UTSW 1 139479348 missense probably damaging 1.00
R2413:Aspm UTSW 1 139477757 missense probably damaging 1.00
R2421:Aspm UTSW 1 139488487 missense possibly damaging 0.49
R3607:Aspm UTSW 1 139480668 missense probably benign 0.13
R3711:Aspm UTSW 1 139458100 missense probably benign 0.17
R3718:Aspm UTSW 1 139480889 missense probably benign 0.09
R3718:Aspm UTSW 1 139490427 missense probably benign 0.31
R3741:Aspm UTSW 1 139478619 missense possibly damaging 0.47
R3788:Aspm UTSW 1 139463203 missense probably damaging 1.00
R3838:Aspm UTSW 1 139478054 missense probably benign 0.24
R3839:Aspm UTSW 1 139478054 missense probably benign 0.24
R3849:Aspm UTSW 1 139458286 missense probably benign 0.21
R4075:Aspm UTSW 1 139474285 missense probably damaging 1.00
R4080:Aspm UTSW 1 139470755 missense probably damaging 1.00
R4463:Aspm UTSW 1 139455010 missense possibly damaging 0.95
R4537:Aspm UTSW 1 139474303 missense probably benign 0.01
R4547:Aspm UTSW 1 139478187 missense possibly damaging 0.75
R4573:Aspm UTSW 1 139479507 missense probably damaging 0.98
R4680:Aspm UTSW 1 139480671 missense probably benign 0.05
R4807:Aspm UTSW 1 139477919 missense probably damaging 1.00
R4840:Aspm UTSW 1 139470531 missense possibly damaging 0.83
R4854:Aspm UTSW 1 139478072 nonsense probably null
R4859:Aspm UTSW 1 139469393 missense probably damaging 1.00
R4893:Aspm UTSW 1 139489839 critical splice donor site probably null
R4910:Aspm UTSW 1 139491543 missense probably damaging 1.00
R4953:Aspm UTSW 1 139471734 missense probably benign 0.00
R4974:Aspm UTSW 1 139478010 missense probably benign 0.03
R5082:Aspm UTSW 1 139478676 nonsense probably null
R5223:Aspm UTSW 1 139478334 missense probably damaging 1.00
R5268:Aspm UTSW 1 139464295 missense probably damaging 1.00
R5371:Aspm UTSW 1 139470541 nonsense probably null
R5377:Aspm UTSW 1 139457483 missense probably damaging 0.96
R5377:Aspm UTSW 1 139470395 splice site probably null
R5481:Aspm UTSW 1 139457061 missense possibly damaging 0.85
R5513:Aspm UTSW 1 139482398 missense probably damaging 1.00
R5578:Aspm UTSW 1 139470717 missense probably damaging 1.00
R5649:Aspm UTSW 1 139479669 missense probably benign
R5685:Aspm UTSW 1 139487288 missense probably benign 0.10
R5695:Aspm UTSW 1 139479669 missense probably benign
R5766:Aspm UTSW 1 139479002 missense probably damaging 0.99
R5964:Aspm UTSW 1 139455227 intron probably benign
R5993:Aspm UTSW 1 139479531 missense probably benign 0.28
R6027:Aspm UTSW 1 139463056 missense probably damaging 1.00
R6029:Aspm UTSW 1 139480990 missense possibly damaging 0.83
R6102:Aspm UTSW 1 139477459 nonsense probably null
R6188:Aspm UTSW 1 139479239 missense possibly damaging 0.79
R6257:Aspm UTSW 1 139482053 splice site probably null
R6433:Aspm UTSW 1 139473683 missense probably damaging 1.00
R6682:Aspm UTSW 1 139457722 missense possibly damaging 0.67
R6763:Aspm UTSW 1 139470517 missense possibly damaging 0.64
R6798:Aspm UTSW 1 139468685 missense possibly damaging 0.66
R6815:Aspm UTSW 1 139480142 missense probably benign 0.04
R6854:Aspm UTSW 1 139463182 missense possibly damaging 0.90
R6928:Aspm UTSW 1 139480206 nonsense probably null
R6943:Aspm UTSW 1 139480542 missense probably damaging 1.00
R6979:Aspm UTSW 1 139480485 missense probably damaging 1.00
R6998:Aspm UTSW 1 139469472 missense probably damaging 1.00
R7126:Aspm UTSW 1 139480803 missense probably benign 0.27
R7237:Aspm UTSW 1 139477929 missense possibly damaging 0.81
R7240:Aspm UTSW 1 139478651 nonsense probably null
R7272:Aspm UTSW 1 139458328 missense probably benign 0.14
R7427:Aspm UTSW 1 139457616 missense probably benign 0.01
R7519:Aspm UTSW 1 139490336 missense possibly damaging 0.53
R7776:Aspm UTSW 1 139479846 missense possibly damaging 0.85
R7875:Aspm UTSW 1 139455134 missense probably benign 0.02
R7883:Aspm UTSW 1 139478667 missense possibly damaging 0.47
R7964:Aspm UTSW 1 139480686 missense probably damaging 1.00
R8012:Aspm UTSW 1 139457464 missense probably benign 0.03
R8029:Aspm UTSW 1 139471632 missense probably benign 0.00
R8233:Aspm UTSW 1 139457304 missense probably benign 0.28
R8277:Aspm UTSW 1 139455010 missense probably damaging 1.00
R8345:Aspm UTSW 1 139464273 nonsense probably null
R8491:Aspm UTSW 1 139457695 missense probably damaging 0.98
R8511:Aspm UTSW 1 139457308 missense probably damaging 1.00
R8557:Aspm UTSW 1 139456756 missense probably benign 0.01
X0063:Aspm UTSW 1 139458090 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGAGCGTCAGAATAAAGCTTCG -3'
(R):5'- CCTGGGGTGTACTTTTAGCAC -3'

Sequencing Primer
(F):5'- GCGTCAGAATAAAGCTTCGTGTCC -3'
(R):5'- CACAGTTCGTAGGATAGACTAA -3'
Posted On2016-05-10