Incidental Mutation 'R4981:Prrc2c'
ID384796
Institutional Source Beutler Lab
Gene Symbol Prrc2c
Ensembl Gene ENSMUSG00000040225
Gene Nameproline-rich coiled-coil 2C
Synonyms9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
MMRRC Submission 042576-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R4981 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162670725-162740556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 162692547 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 2076 (R2076S)
Ref Sequence ENSEMBL: ENSMUSP00000138674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028016] [ENSMUST00000182149] [ENSMUST00000182393] [ENSMUST00000182593] [ENSMUST00000182660] [ENSMUST00000183223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028016
AA Change: R2076S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028016
Gene: ENSMUSG00000040225
AA Change: R2076S

DomainStartEndE-ValueType
Pfam:BAT2_N 1 164 7.7e-56 PFAM
internal_repeat_2 167 349 4.39e-5 PROSPERO
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182149
AA Change: R2078S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138548
Gene: ENSMUSG00000040225
AA Change: R2078S

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 5.6e-73 PFAM
internal_repeat_1 336 391 1.49e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
internal_repeat_3 754 925 9.16e-5 PROSPERO
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 1.49e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 3.08e-5 PROSPERO
internal_repeat_3 1983 2153 9.16e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182393
AA Change: R794S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138451
Gene: ENSMUSG00000040225
AA Change: R794S

DomainStartEndE-ValueType
low complexity region 24 51 N/A INTRINSIC
low complexity region 104 125 N/A INTRINSIC
low complexity region 431 462 N/A INTRINSIC
low complexity region 481 519 N/A INTRINSIC
low complexity region 531 548 N/A INTRINSIC
low complexity region 560 625 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 946 968 N/A INTRINSIC
low complexity region 988 1002 N/A INTRINSIC
low complexity region 1037 1054 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1274 1297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182535
Predicted Effect probably damaging
Transcript: ENSMUST00000182593
AA Change: R2076S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138674
Gene: ENSMUSG00000040225
AA Change: R2076S

DomainStartEndE-ValueType
Pfam:BAT2_N 1 165 4.1e-70 PFAM
internal_repeat_1 334 389 9.57e-6 PROSPERO
low complexity region 405 412 N/A INTRINSIC
SCOP:d1eq1a_ 445 589 3e-5 SMART
low complexity region 647 667 N/A INTRINSIC
low complexity region 731 743 N/A INTRINSIC
internal_repeat_3 752 923 6.11e-5 PROSPERO
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1155 1184 N/A INTRINSIC
low complexity region 1210 1220 N/A INTRINSIC
internal_repeat_1 1238 1293 9.57e-6 PROSPERO
low complexity region 1306 1333 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1713 1744 N/A INTRINSIC
low complexity region 1763 1801 N/A INTRINSIC
low complexity region 1813 1830 N/A INTRINSIC
low complexity region 1842 1907 N/A INTRINSIC
internal_repeat_2 1960 2146 2.01e-5 PROSPERO
internal_repeat_3 1981 2151 6.11e-5 PROSPERO
low complexity region 2161 2175 N/A INTRINSIC
low complexity region 2228 2250 N/A INTRINSIC
low complexity region 2270 2284 N/A INTRINSIC
low complexity region 2319 2336 N/A INTRINSIC
low complexity region 2425 2436 N/A INTRINSIC
low complexity region 2551 2574 N/A INTRINSIC
low complexity region 2671 2682 N/A INTRINSIC
low complexity region 2730 2747 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182660
AA Change: R2078S

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138433
Gene: ENSMUSG00000040225
AA Change: R2078S

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 7e-73 PFAM
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183223
AA Change: R652S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138698
Gene: ENSMUSG00000040225
AA Change: R652S

DomainStartEndE-ValueType
low complexity region 289 320 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 418 483 N/A INTRINSIC
low complexity region 739 761 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
low complexity region 830 847 N/A INTRINSIC
low complexity region 936 947 N/A INTRINSIC
low complexity region 1062 1085 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1241 1258 N/A INTRINSIC
Meta Mutation Damage Score 0.1166 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (105/105)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,048,987 probably null Het
Aatf T C 11: 84,511,497 D121G probably benign Het
Amer2 T A 14: 60,379,727 L331H probably damaging Het
Ang4 T G 14: 51,764,372 K40Q probably benign Het
Aspm A C 1: 139,470,760 probably null Het
Cacna1c A T 6: 118,751,471 D337E probably benign Het
Ccdc124 T C 8: 70,868,785 E134G probably benign Het
Ccdc7a G T 8: 128,984,983 A312E probably benign Het
Ccdc84 A T 9: 44,417,948 F14Y probably damaging Het
Cd209g A G 8: 4,136,845 D130G probably damaging Het
Cd320 T C 17: 33,847,575 S96P probably benign Het
Clu C G 14: 65,973,366 Q134E probably damaging Het
Cnksr3 T A 10: 7,160,777 H28L probably benign Het
Cntnap1 T C 11: 101,176,333 probably null Het
Col22a1 C T 15: 71,861,066 C546Y unknown Het
Col6a3 C T 1: 90,778,843 V2183I unknown Het
Cop1 A G 1: 159,325,068 probably benign Het
Cpne8 T C 15: 90,679,235 I24V probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Dennd5b G A 6: 149,009,772 L978F possibly damaging Het
Depdc1a G T 3: 159,523,913 M627I probably benign Het
Dnah3 A T 7: 119,956,201 N2721K probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg1b A G 18: 20,408,868 T811A possibly damaging Het
Emilin1 C G 5: 30,919,351 Q847E probably benign Het
Epha3 A T 16: 63,652,412 V370D probably benign Het
Epha5 T A 5: 84,150,483 T406S probably damaging Het
Ephb1 A T 9: 102,040,960 I450N probably benign Het
Ephb2 A G 4: 136,696,010 M319T probably benign Het
Eps15l1 A G 8: 72,378,989 probably null Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fgd5 T C 6: 91,989,300 I838T probably damaging Het
Fnbp4 T C 2: 90,765,830 F582L probably damaging Het
Frs3 T C 17: 47,689,262 probably null Het
Fscb C T 12: 64,473,619 V358I possibly damaging Het
Fus G T 7: 127,967,555 probably benign Het
Fyb CCTCTCTCTCTCTCTCTCTCT CCTCTCTCTCTCTCTCTCT 15: 6,646,611 probably benign Het
Glra3 A T 8: 55,991,235 I77F possibly damaging Het
Gm4454 C T 7: 38,570,436 noncoding transcript Het
Gng3 G A 19: 8,838,261 A37V possibly damaging Het
Grin3b T A 10: 79,976,357 probably benign Het
Herpud1 A G 8: 94,391,794 Y41C probably damaging Het
Igkv4-92 G C 6: 68,755,044 S115R possibly damaging Het
Ikbip T A 10: 91,095,986 I164N probably benign Het
Kank1 A G 19: 25,411,395 T783A probably benign Het
Kcnq3 A T 15: 66,031,405 V152E possibly damaging Het
Kif23 C T 9: 61,931,871 R314H probably damaging Het
Klc4 T C 17: 46,644,361 H49R probably benign Het
Klhl20 A T 1: 161,103,005 I309N possibly damaging Het
Lgals4 A G 7: 28,841,276 Y268C probably damaging Het
Lingo4 A G 3: 94,399,454 Q13R probably benign Het
Lmtk2 C A 5: 144,176,447 F1328L probably damaging Het
Mapk14 A G 17: 28,741,791 R179G probably damaging Het
Mbd3l1 A T 9: 18,484,905 T109S probably benign Het
Megf6 T C 4: 154,267,450 F1169L possibly damaging Het
Mrgpra1 A T 7: 47,335,211 V240D probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myh1 T C 11: 67,224,474 probably benign Het
Nav3 T C 10: 109,880,692 I172V probably benign Het
Nemp1 T A 10: 127,693,530 L178Q probably damaging Het
Numa1 T C 7: 101,992,674 S110P probably damaging Het
Olfr1076 T C 2: 86,508,827 Y123H probably damaging Het
Olfr1222 T C 2: 89,125,501 T77A probably benign Het
Olfr1248 A G 2: 89,617,425 Y256H probably damaging Het
Olfr1500 A T 19: 13,828,094 F101I probably damaging Het
Olfr639 A G 7: 104,012,105 I199T probably damaging Het
Olfr995 A G 2: 85,438,469 S230P probably damaging Het
Pard3b T G 1: 62,344,060 M771R probably damaging Het
Phkg2 A G 7: 127,582,379 I245V probably damaging Het
Pik3cg A T 12: 32,204,104 M628K possibly damaging Het
Poln A G 5: 34,107,085 probably null Het
Ppip5k1 A T 2: 121,312,390 S1172T probably damaging Het
Prdm5 A T 6: 65,870,462 H363L probably damaging Het
Prkdc A G 16: 15,678,309 Y788C probably damaging Het
Sh2d2a A G 3: 87,849,421 Y191C probably damaging Het
Slc20a1 T C 2: 129,199,999 I94T probably damaging Het
Sptbn2 T C 19: 4,751,658 V2366A probably benign Het
Stab2 T A 10: 86,960,223 M387L probably benign Het
Syne2 T G 12: 75,941,219 M1718R probably damaging Het
Synm G T 7: 67,734,487 F700L probably benign Het
Tmco4 T C 4: 138,990,701 F51L possibly damaging Het
Tmem104 C A 11: 115,205,136 P168T probably damaging Het
Tril G T 6: 53,818,920 T439K probably benign Het
Trim2 A G 3: 84,177,735 L559P probably damaging Het
Trim3 A G 7: 105,619,128 V149A probably damaging Het
Triml2 A G 8: 43,187,680 N191S probably benign Het
Usp4 A G 9: 108,381,418 D16G probably benign Het
Vmn2r58 G A 7: 41,837,461 T670I probably damaging Het
Vmn2r97 G T 17: 18,940,174 G524* probably null Het
Xpo5 C A 17: 46,220,817 F426L probably damaging Het
Zfp800 A G 6: 28,247,191 L84S probably damaging Het
Zranb2 T G 3: 157,546,741 probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Prrc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Prrc2c APN 1 162720613 splice site probably null
IGL00577:Prrc2c APN 1 162698116 missense unknown
IGL00580:Prrc2c APN 1 162698116 missense unknown
IGL01295:Prrc2c APN 1 162682492 missense probably damaging 1.00
IGL01554:Prrc2c APN 1 162710786 missense probably damaging 0.99
IGL01684:Prrc2c APN 1 162706462 unclassified probably benign
IGL01745:Prrc2c APN 1 162724728 missense probably damaging 1.00
IGL01770:Prrc2c APN 1 162704499 missense probably benign 0.23
IGL01905:Prrc2c APN 1 162705329 unclassified probably benign
IGL02304:Prrc2c APN 1 162684136 missense probably benign 0.05
IGL02389:Prrc2c APN 1 162692870 missense probably damaging 1.00
IGL02540:Prrc2c APN 1 162723137 missense probably damaging 1.00
IGL02681:Prrc2c APN 1 162705612 unclassified probably benign
IGL02686:Prrc2c APN 1 162707947 unclassified probably benign
IGL02795:Prrc2c APN 1 162714299 missense probably benign
IGL02894:Prrc2c APN 1 162678057 missense probably damaging 1.00
IGL02957:Prrc2c APN 1 162706535 unclassified probably benign
IGL02981:Prrc2c APN 1 162705179 unclassified probably benign
IGL03070:Prrc2c APN 1 162677409 missense probably damaging 1.00
IGL03096:Prrc2c APN 1 162702359 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0135:Prrc2c UTSW 1 162715483 splice site probably benign
R0279:Prrc2c UTSW 1 162715464 missense probably damaging 1.00
R0363:Prrc2c UTSW 1 162697811 missense unknown
R0436:Prrc2c UTSW 1 162705314 unclassified probably benign
R0605:Prrc2c UTSW 1 162682426 missense probably damaging 1.00
R0696:Prrc2c UTSW 1 162708852 critical splice donor site probably null
R0981:Prrc2c UTSW 1 162705981 unclassified probably benign
R1693:Prrc2c UTSW 1 162718713 missense probably damaging 0.98
R1714:Prrc2c UTSW 1 162677376 missense probably damaging 1.00
R1791:Prrc2c UTSW 1 162704982 unclassified probably benign
R1794:Prrc2c UTSW 1 162705959 unclassified probably benign
R1998:Prrc2c UTSW 1 162704918 unclassified probably benign
R2040:Prrc2c UTSW 1 162697557 missense probably damaging 1.00
R2168:Prrc2c UTSW 1 162710334 unclassified probably benign
R2246:Prrc2c UTSW 1 162707791 unclassified probably benign
R2830:Prrc2c UTSW 1 162708916 unclassified probably benign
R2926:Prrc2c UTSW 1 162706127 unclassified probably benign
R3703:Prrc2c UTSW 1 162710691 missense probably damaging 1.00
R3745:Prrc2c UTSW 1 162698185 missense unknown
R3760:Prrc2c UTSW 1 162692851 missense probably damaging 1.00
R3784:Prrc2c UTSW 1 162709669 unclassified probably benign
R3959:Prrc2c UTSW 1 162708892 unclassified probably benign
R4255:Prrc2c UTSW 1 162706326 unclassified probably benign
R4276:Prrc2c UTSW 1 162673591 missense probably damaging 1.00
R4421:Prrc2c UTSW 1 162709061 unclassified probably benign
R4593:Prrc2c UTSW 1 162697532 missense probably damaging 1.00
R4651:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4652:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4660:Prrc2c UTSW 1 162680895 missense probably damaging 1.00
R4677:Prrc2c UTSW 1 162705179 unclassified probably benign
R4688:Prrc2c UTSW 1 162697687 missense unknown
R4753:Prrc2c UTSW 1 162691230 missense probably damaging 1.00
R4790:Prrc2c UTSW 1 162710481 missense unknown
R4995:Prrc2c UTSW 1 162705310 unclassified probably benign
R5119:Prrc2c UTSW 1 162705440 unclassified probably benign
R5127:Prrc2c UTSW 1 162697846 missense unknown
R5291:Prrc2c UTSW 1 162705582 unclassified probably benign
R5474:Prrc2c UTSW 1 162709644 unclassified probably benign
R5543:Prrc2c UTSW 1 162673511 missense probably damaging 0.99
R5579:Prrc2c UTSW 1 162680758 critical splice donor site probably null
R5594:Prrc2c UTSW 1 162699031 missense unknown
R5620:Prrc2c UTSW 1 162673529 missense probably damaging 1.00
R5994:Prrc2c UTSW 1 162674156 splice site probably null
R6142:Prrc2c UTSW 1 162710387 missense unknown
R6199:Prrc2c UTSW 1 162682516 missense probably damaging 1.00
R6277:Prrc2c UTSW 1 162714314 missense probably benign
R6504:Prrc2c UTSW 1 162697795 missense unknown
R6671:Prrc2c UTSW 1 162697585 missense probably damaging 1.00
R6785:Prrc2c UTSW 1 162709101 unclassified probably benign
R6799:Prrc2c UTSW 1 162709061 unclassified probably benign
R6801:Prrc2c UTSW 1 162709061 unclassified probably benign
R6850:Prrc2c UTSW 1 162709061 unclassified probably benign
R6851:Prrc2c UTSW 1 162709061 unclassified probably benign
R6856:Prrc2c UTSW 1 162682371 missense probably damaging 1.00
R6869:Prrc2c UTSW 1 162709061 unclassified probably benign
R6882:Prrc2c UTSW 1 162709061 unclassified probably benign
R6884:Prrc2c UTSW 1 162709061 unclassified probably benign
R6897:Prrc2c UTSW 1 162705506 unclassified probably benign
R6934:Prrc2c UTSW 1 162720505 missense probably benign 0.10
R6976:Prrc2c UTSW 1 162692844 missense probably damaging 1.00
R7132:Prrc2c UTSW 1 162681281 missense possibly damaging 0.77
R7165:Prrc2c UTSW 1 162673517 missense possibly damaging 0.94
R7282:Prrc2c UTSW 1 162679974 missense possibly damaging 0.59
R7467:Prrc2c UTSW 1 162677363 missense possibly damaging 0.84
R8068:Prrc2c UTSW 1 162709061 unclassified probably benign
X0020:Prrc2c UTSW 1 162707847 unclassified probably benign
X0039:Prrc2c UTSW 1 162704793 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTCAGTGTGTACTTACCTTTGC -3'
(R):5'- GGCCCATTAAAGCTCAGAAGG -3'

Sequencing Primer
(F):5'- GTGTACTTACCTTTGCATCAGAG -3'
(R):5'- TAAAGCTCAGAAGGTAGGTGCTGTTC -3'
Posted On2016-05-10