Incidental Mutation 'R0347:Rgl2'
ID 38483
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 038554-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R0347 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34151712 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 252 (T252I)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047503
AA Change: T252I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: T252I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Meta Mutation Damage Score 0.8863 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,913,748 (GRCm39) E908G probably benign Het
Abcb5 T A 12: 118,928,986 (GRCm39) probably benign Het
Adhfe1 T A 1: 9,623,655 (GRCm39) F102Y probably benign Het
Aff4 A G 11: 53,290,915 (GRCm39) Y625C probably benign Het
Alox5 T C 6: 116,390,513 (GRCm39) E488G possibly damaging Het
Ankmy2 T C 12: 36,243,753 (GRCm39) C323R probably damaging Het
Ankrd28 A G 14: 31,423,979 (GRCm39) *1084R probably null Het
Apol10a A T 15: 77,372,891 (GRCm39) I176F probably damaging Het
Arhgap26 C T 18: 38,750,797 (GRCm39) T70I unknown Het
Arid2 A G 15: 96,268,833 (GRCm39) N982S probably benign Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Camsap3 A G 8: 3,652,029 (GRCm39) D291G probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Cdc20b G T 13: 113,196,361 (GRCm39) G162V probably damaging Het
Cep44 T G 8: 56,998,510 (GRCm39) E56A probably damaging Het
Cfap410 A T 10: 77,820,256 (GRCm39) I209F probably damaging Het
Cfap65 A G 1: 74,965,603 (GRCm39) L469P probably damaging Het
Cilp T A 9: 65,187,435 (GRCm39) C1177S probably benign Het
Ctnnbip1 C T 4: 149,630,211 (GRCm39) P7S probably damaging Het
Cyp11a1 T C 9: 57,923,543 (GRCm39) probably benign Het
Cyp3a11 C T 5: 145,802,735 (GRCm39) V253M possibly damaging Het
D630045J12Rik C A 6: 38,158,327 (GRCm39) V1117L probably damaging Het
Dnah7b T A 1: 46,280,104 (GRCm39) S2678T probably damaging Het
Dock1 T C 7: 134,365,596 (GRCm39) I428T probably damaging Het
Fam83f A G 15: 80,556,458 (GRCm39) D114G probably damaging Het
Flt3 T A 5: 147,294,802 (GRCm39) N423I probably damaging Het
Fnbp1l A T 3: 122,383,824 (GRCm39) F31L probably damaging Het
Glrx3 G A 7: 137,039,430 (GRCm39) E10K unknown Het
Gm12185 T C 11: 48,806,009 (GRCm39) E394G probably benign Het
Gpatch1 C T 7: 34,997,056 (GRCm39) V381M probably benign Het
Grm8 T C 6: 27,981,221 (GRCm39) S230G probably benign Het
Heyl A T 4: 123,127,733 (GRCm39) D25V probably benign Het
Junb G A 8: 85,705,107 (GRCm39) probably benign Het
Klhl29 C A 12: 5,134,354 (GRCm39) V747F probably damaging Het
Krt77 T C 15: 101,768,304 (GRCm39) H569R unknown Het
Ldhb T C 6: 142,439,859 (GRCm39) N227S probably benign Het
Megf6 A G 4: 154,339,092 (GRCm39) D543G possibly damaging Het
Mrps23 A T 11: 88,101,519 (GRCm39) Q136L probably benign Het
Myh2 C T 11: 67,076,130 (GRCm39) probably benign Het
Nadk2 T A 15: 9,084,287 (GRCm39) D133E probably benign Het
Neurod4 G A 10: 130,106,980 (GRCm39) T98I probably damaging Het
Nfatc2 G T 2: 168,378,210 (GRCm39) T465K probably damaging Het
Nipbl A G 15: 8,380,216 (GRCm39) S859P probably benign Het
Nipsnap3a T C 4: 52,997,155 (GRCm39) probably benign Het
Nlrp4c A G 7: 6,069,415 (GRCm39) K439E possibly damaging Het
Or10q3 A T 19: 11,847,797 (GRCm39) L261H probably damaging Het
Or1e32 C T 11: 73,705,137 (GRCm39) G257D probably damaging Het
Or2a20 T C 6: 43,194,296 (GRCm39) F150L probably benign Het
Pds5b T A 5: 150,659,892 (GRCm39) probably benign Het
Pira13 A T 7: 3,825,873 (GRCm39) V332E probably damaging Het
Plch1 A G 3: 63,660,737 (GRCm39) M282T probably damaging Het
Plch2 C A 4: 155,071,178 (GRCm39) R1067L possibly damaging Het
Polr1has T A 17: 37,276,207 (GRCm39) M114K probably damaging Het
Pou2f2 A C 7: 24,797,126 (GRCm39) F206V probably damaging Het
Prss50 A G 9: 110,691,418 (GRCm39) I49V probably damaging Het
Rexo5 T A 7: 119,423,119 (GRCm39) probably null Het
Rp1l1 A T 14: 64,268,253 (GRCm39) K1280* probably null Het
Rpl24 T A 16: 55,790,540 (GRCm39) probably null Het
Satb1 T A 17: 52,046,934 (GRCm39) K763* probably null Het
Scart2 T A 7: 139,877,767 (GRCm39) H800Q probably damaging Het
Sema6a T A 18: 47,424,196 (GRCm39) R237S probably damaging Het
Spg11 T C 2: 121,927,850 (GRCm39) T645A probably damaging Het
Srrt T A 5: 137,297,938 (GRCm39) probably benign Het
Tanc1 T C 2: 59,673,335 (GRCm39) V1480A probably benign Het
Tbc1d2 T C 4: 46,620,574 (GRCm39) D412G possibly damaging Het
Tecrl T C 5: 83,442,479 (GRCm39) E198G probably damaging Het
Tigd4 A G 3: 84,501,167 (GRCm39) D28G probably damaging Het
Trp53bp2 T G 1: 182,269,213 (GRCm39) L226V probably benign Het
Ttll13 T C 7: 79,910,253 (GRCm39) S799P possibly damaging Het
Vps13c A T 9: 67,817,515 (GRCm39) Q1062H possibly damaging Het
Wnt10a T G 1: 74,832,702 (GRCm39) H98Q probably damaging Het
Zbtb47 C T 9: 121,592,168 (GRCm39) P198S probably damaging Het
Zfp959 T A 17: 56,204,180 (GRCm39) Y69* probably null Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTTGAGAGCTTCTTGCTTCGGAC -3'
(R):5'- CGCCACCTTGTTGAACTGTGTGAC -3'

Sequencing Primer
(F):5'- CTTCGGACAGGGTATGCAG -3'
(R):5'- CAAGTTTCCAGTATCAGGGATCTGAG -3'
Posted On 2013-05-23