Incidental Mutation 'R4981:Olfr639'
ID384830
Institutional Source Beutler Lab
Gene Symbol Olfr639
Ensembl Gene ENSMUSG00000066263
Gene Nameolfactory receptor 639
SynonymsMOR12-1, GA_x6K02T2PBJ9-6747143-6746193
MMRRC Submission 042576-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4981 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104006231-104017303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104012105 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 199 (I199T)
Ref Sequence ENSEMBL: ENSMUSP00000149743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106862] [ENSMUST00000138055] [ENSMUST00000215653]
Predicted Effect probably damaging
Transcript: ENSMUST00000106862
AA Change: I199T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102475
Gene: ENSMUSG00000066263
AA Change: I199T

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.4e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 173 3.6e-9 PFAM
Pfam:7tm_1 43 294 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215653
AA Change: I199T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (105/105)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,048,987 probably null Het
Aatf T C 11: 84,511,497 D121G probably benign Het
Amer2 T A 14: 60,379,727 L331H probably damaging Het
Ang4 T G 14: 51,764,372 K40Q probably benign Het
Aspm A C 1: 139,470,760 probably null Het
Cacna1c A T 6: 118,751,471 D337E probably benign Het
Ccdc124 T C 8: 70,868,785 E134G probably benign Het
Ccdc7a G T 8: 128,984,983 A312E probably benign Het
Ccdc84 A T 9: 44,417,948 F14Y probably damaging Het
Cd209g A G 8: 4,136,845 D130G probably damaging Het
Cd320 T C 17: 33,847,575 S96P probably benign Het
Clu C G 14: 65,973,366 Q134E probably damaging Het
Cnksr3 T A 10: 7,160,777 H28L probably benign Het
Cntnap1 T C 11: 101,176,333 probably null Het
Col22a1 C T 15: 71,861,066 C546Y unknown Het
Col6a3 C T 1: 90,778,843 V2183I unknown Het
Cop1 A G 1: 159,325,068 probably benign Het
Cpne8 T C 15: 90,679,235 I24V probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Dennd5b G A 6: 149,009,772 L978F possibly damaging Het
Depdc1a G T 3: 159,523,913 M627I probably benign Het
Dnah3 A T 7: 119,956,201 N2721K probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg1b A G 18: 20,408,868 T811A possibly damaging Het
Emilin1 C G 5: 30,919,351 Q847E probably benign Het
Epha3 A T 16: 63,652,412 V370D probably benign Het
Epha5 T A 5: 84,150,483 T406S probably damaging Het
Ephb1 A T 9: 102,040,960 I450N probably benign Het
Ephb2 A G 4: 136,696,010 M319T probably benign Het
Eps15l1 A G 8: 72,378,989 probably null Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fgd5 T C 6: 91,989,300 I838T probably damaging Het
Fnbp4 T C 2: 90,765,830 F582L probably damaging Het
Frs3 T C 17: 47,689,262 probably null Het
Fscb C T 12: 64,473,619 V358I possibly damaging Het
Fus G T 7: 127,967,555 probably benign Het
Fyb CCTCTCTCTCTCTCTCTCTCT CCTCTCTCTCTCTCTCTCT 15: 6,646,611 probably benign Het
Glra3 A T 8: 55,991,235 I77F possibly damaging Het
Gm4454 C T 7: 38,570,436 noncoding transcript Het
Gng3 G A 19: 8,838,261 A37V possibly damaging Het
Grin3b T A 10: 79,976,357 probably benign Het
Herpud1 A G 8: 94,391,794 Y41C probably damaging Het
Igkv4-92 G C 6: 68,755,044 S115R possibly damaging Het
Ikbip T A 10: 91,095,986 I164N probably benign Het
Kank1 A G 19: 25,411,395 T783A probably benign Het
Kcnq3 A T 15: 66,031,405 V152E possibly damaging Het
Kif23 C T 9: 61,931,871 R314H probably damaging Het
Klc4 T C 17: 46,644,361 H49R probably benign Het
Klhl20 A T 1: 161,103,005 I309N possibly damaging Het
Lgals4 A G 7: 28,841,276 Y268C probably damaging Het
Lingo4 A G 3: 94,399,454 Q13R probably benign Het
Lmtk2 C A 5: 144,176,447 F1328L probably damaging Het
Mapk14 A G 17: 28,741,791 R179G probably damaging Het
Mbd3l1 A T 9: 18,484,905 T109S probably benign Het
Megf6 T C 4: 154,267,450 F1169L possibly damaging Het
Mrgpra1 A T 7: 47,335,211 V240D probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myh1 T C 11: 67,224,474 probably benign Het
Nav3 T C 10: 109,880,692 I172V probably benign Het
Nemp1 T A 10: 127,693,530 L178Q probably damaging Het
Numa1 T C 7: 101,992,674 S110P probably damaging Het
Olfr1076 T C 2: 86,508,827 Y123H probably damaging Het
Olfr1222 T C 2: 89,125,501 T77A probably benign Het
Olfr1248 A G 2: 89,617,425 Y256H probably damaging Het
Olfr1500 A T 19: 13,828,094 F101I probably damaging Het
Olfr995 A G 2: 85,438,469 S230P probably damaging Het
Pard3b T G 1: 62,344,060 M771R probably damaging Het
Phkg2 A G 7: 127,582,379 I245V probably damaging Het
Pik3cg A T 12: 32,204,104 M628K possibly damaging Het
Poln A G 5: 34,107,085 probably null Het
Ppip5k1 A T 2: 121,312,390 S1172T probably damaging Het
Prdm5 A T 6: 65,870,462 H363L probably damaging Het
Prkdc A G 16: 15,678,309 Y788C probably damaging Het
Prrc2c T A 1: 162,692,547 R2076S probably damaging Het
Sh2d2a A G 3: 87,849,421 Y191C probably damaging Het
Slc20a1 T C 2: 129,199,999 I94T probably damaging Het
Sptbn2 T C 19: 4,751,658 V2366A probably benign Het
Stab2 T A 10: 86,960,223 M387L probably benign Het
Syne2 T G 12: 75,941,219 M1718R probably damaging Het
Synm G T 7: 67,734,487 F700L probably benign Het
Tmco4 T C 4: 138,990,701 F51L possibly damaging Het
Tmem104 C A 11: 115,205,136 P168T probably damaging Het
Tril G T 6: 53,818,920 T439K probably benign Het
Trim2 A G 3: 84,177,735 L559P probably damaging Het
Trim3 A G 7: 105,619,128 V149A probably damaging Het
Triml2 A G 8: 43,187,680 N191S probably benign Het
Usp4 A G 9: 108,381,418 D16G probably benign Het
Vmn2r58 G A 7: 41,837,461 T670I probably damaging Het
Vmn2r97 G T 17: 18,940,174 G524* probably null Het
Xpo5 C A 17: 46,220,817 F426L probably damaging Het
Zfp800 A G 6: 28,247,191 L84S probably damaging Het
Zranb2 T G 3: 157,546,741 probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Olfr639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr639 APN 7 104012114 missense probably damaging 1.00
IGL01547:Olfr639 APN 7 104012660 missense probably benign 0.43
IGL02173:Olfr639 APN 7 104011830 missense probably damaging 1.00
IGL02707:Olfr639 APN 7 104012402 missense probably damaging 1.00
IGL03124:Olfr639 APN 7 104011794 missense probably benign
R0004:Olfr639 UTSW 7 104012431 missense probably benign 0.02
R0086:Olfr639 UTSW 7 104012054 missense probably benign 0.23
R0370:Olfr639 UTSW 7 104012059 missense probably damaging 0.99
R0599:Olfr639 UTSW 7 104012188 nonsense probably null
R1351:Olfr639 UTSW 7 104012316 missense possibly damaging 0.81
R1604:Olfr639 UTSW 7 104011955 missense probably damaging 1.00
R2314:Olfr639 UTSW 7 104012229 missense probably benign 0.09
R2656:Olfr639 UTSW 7 104011865 missense probably damaging 0.96
R4594:Olfr639 UTSW 7 104012417 missense probably benign 0.01
R4774:Olfr639 UTSW 7 104012588 missense probably benign 0.00
R4945:Olfr639 UTSW 7 104012378 missense possibly damaging 0.85
R4968:Olfr639 UTSW 7 104012570 missense probably damaging 1.00
R5072:Olfr639 UTSW 7 104012118 missense probably damaging 0.97
R5982:Olfr639 UTSW 7 104011910 missense probably damaging 1.00
R6303:Olfr639 UTSW 7 104012031 missense probably damaging 1.00
R6304:Olfr639 UTSW 7 104012031 missense probably damaging 1.00
R6332:Olfr639 UTSW 7 104011773 missense probably benign 0.00
R7107:Olfr639 UTSW 7 104012282 missense probably benign 0.16
R7152:Olfr639 UTSW 7 104012019 missense probably benign
R7456:Olfr639 UTSW 7 104011838 missense possibly damaging 0.83
R7849:Olfr639 UTSW 7 104012303 missense possibly damaging 0.56
R8023:Olfr639 UTSW 7 104011799 missense probably damaging 0.97
R8082:Olfr639 UTSW 7 104012690 missense probably benign 0.04
R8215:Olfr639 UTSW 7 104012123 missense possibly damaging 0.85
R8428:Olfr639 UTSW 7 104012425 nonsense probably null
Z1177:Olfr639 UTSW 7 104012150 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCACTGGTGATGCATGCTTG -3'
(R):5'- AACTCTGCCTCGGATCATATCC -3'

Sequencing Primer
(F):5'- GTGATGCATGCTTGGCAAC -3'
(R):5'- CCATGGGTCTGGGTATTACACTAAAG -3'
Posted On2016-05-10