Incidental Mutation 'R4981:Stab2'
ID 384849
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms STAB-2, FEEL-2
MMRRC Submission 042576-MU
Accession Numbers

Genbank: NM_138673; MGI: 2178743
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4981 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86841198-87008025 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86960223 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 387 (M387L)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably benign
Transcript: ENSMUST00000035288
AA Change: M387L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: M387L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 100% (105/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,048,987 probably null Het
Aatf T C 11: 84,511,497 D121G probably benign Het
Amer2 T A 14: 60,379,727 L331H probably damaging Het
Ang4 T G 14: 51,764,372 K40Q probably benign Het
Aspm A C 1: 139,470,760 probably null Het
Cacna1c A T 6: 118,751,471 D337E probably benign Het
Ccdc124 T C 8: 70,868,785 E134G probably benign Het
Ccdc7a G T 8: 128,984,983 A312E probably benign Het
Ccdc84 A T 9: 44,417,948 F14Y probably damaging Het
Cd209g A G 8: 4,136,845 D130G probably damaging Het
Cd320 T C 17: 33,847,575 S96P probably benign Het
Clu C G 14: 65,973,366 Q134E probably damaging Het
Cnksr3 T A 10: 7,160,777 H28L probably benign Het
Cntnap1 T C 11: 101,176,333 probably null Het
Col22a1 C T 15: 71,861,066 C546Y unknown Het
Col6a3 C T 1: 90,778,843 V2183I unknown Het
Cop1 A G 1: 159,325,068 probably benign Het
Cpne8 T C 15: 90,679,235 I24V probably benign Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Dennd5b G A 6: 149,009,772 L978F possibly damaging Het
Depdc1a G T 3: 159,523,913 M627I probably benign Het
Dnah3 A T 7: 119,956,201 N2721K probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg1b A G 18: 20,408,868 T811A possibly damaging Het
Emilin1 C G 5: 30,919,351 Q847E probably benign Het
Epha3 A T 16: 63,652,412 V370D probably benign Het
Epha5 T A 5: 84,150,483 T406S probably damaging Het
Ephb1 A T 9: 102,040,960 I450N probably benign Het
Ephb2 A G 4: 136,696,010 M319T probably benign Het
Eps15l1 A G 8: 72,378,989 probably null Het
Fbxo9 G A 9: 78,085,886 probably benign Het
Fgd5 T C 6: 91,989,300 I838T probably damaging Het
Fnbp4 T C 2: 90,765,830 F582L probably damaging Het
Frs3 T C 17: 47,689,262 probably null Het
Fscb C T 12: 64,473,619 V358I possibly damaging Het
Fus G T 7: 127,967,555 probably benign Het
Fyb CCTCTCTCTCTCTCTCTCTCT CCTCTCTCTCTCTCTCTCT 15: 6,646,611 probably benign Het
Glra3 A T 8: 55,991,235 I77F possibly damaging Het
Gm4454 C T 7: 38,570,436 noncoding transcript Het
Gng3 G A 19: 8,838,261 A37V possibly damaging Het
Grin3b T A 10: 79,976,357 probably benign Het
Herpud1 A G 8: 94,391,794 Y41C probably damaging Het
Igkv4-92 G C 6: 68,755,044 S115R possibly damaging Het
Ikbip T A 10: 91,095,986 I164N probably benign Het
Kank1 A G 19: 25,411,395 T783A probably benign Het
Kcnq3 A T 15: 66,031,405 V152E possibly damaging Het
Kif23 C T 9: 61,931,871 R314H probably damaging Het
Klc4 T C 17: 46,644,361 H49R probably benign Het
Klhl20 A T 1: 161,103,005 I309N possibly damaging Het
Lgals4 A G 7: 28,841,276 Y268C probably damaging Het
Lingo4 A G 3: 94,399,454 Q13R probably benign Het
Lmtk2 C A 5: 144,176,447 F1328L probably damaging Het
Mapk14 A G 17: 28,741,791 R179G probably damaging Het
Mbd3l1 A T 9: 18,484,905 T109S probably benign Het
Megf6 T C 4: 154,267,450 F1169L possibly damaging Het
Mrgpra1 A T 7: 47,335,211 V240D probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myh1 T C 11: 67,224,474 probably benign Het
Nav3 T C 10: 109,880,692 I172V probably benign Het
Nemp1 T A 10: 127,693,530 L178Q probably damaging Het
Numa1 T C 7: 101,992,674 S110P probably damaging Het
Olfr1076 T C 2: 86,508,827 Y123H probably damaging Het
Olfr1222 T C 2: 89,125,501 T77A probably benign Het
Olfr1248 A G 2: 89,617,425 Y256H probably damaging Het
Olfr1500 A T 19: 13,828,094 F101I probably damaging Het
Olfr639 A G 7: 104,012,105 I199T probably damaging Het
Olfr995 A G 2: 85,438,469 S230P probably damaging Het
Pard3b T G 1: 62,344,060 M771R probably damaging Het
Phkg2 A G 7: 127,582,379 I245V probably damaging Het
Pik3cg A T 12: 32,204,104 M628K possibly damaging Het
Poln A G 5: 34,107,085 probably null Het
Ppip5k1 A T 2: 121,312,390 S1172T probably damaging Het
Prdm5 A T 6: 65,870,462 H363L probably damaging Het
Prkdc A G 16: 15,678,309 Y788C probably damaging Het
Prrc2c T A 1: 162,692,547 R2076S probably damaging Het
Sh2d2a A G 3: 87,849,421 Y191C probably damaging Het
Slc20a1 T C 2: 129,199,999 I94T probably damaging Het
Sptbn2 T C 19: 4,751,658 V2366A probably benign Het
Syne2 T G 12: 75,941,219 M1718R probably damaging Het
Synm G T 7: 67,734,487 F700L probably benign Het
Tmco4 T C 4: 138,990,701 F51L possibly damaging Het
Tmem104 C A 11: 115,205,136 P168T probably damaging Het
Tril G T 6: 53,818,920 T439K probably benign Het
Trim2 A G 3: 84,177,735 L559P probably damaging Het
Trim3 A G 7: 105,619,128 V149A probably damaging Het
Triml2 A G 8: 43,187,680 N191S probably benign Het
Usp4 A G 9: 108,381,418 D16G probably benign Het
Vmn2r58 G A 7: 41,837,461 T670I probably damaging Het
Vmn2r97 G T 17: 18,940,174 G524* probably null Het
Xpo5 C A 17: 46,220,817 F426L probably damaging Het
Zfp800 A G 6: 28,247,191 L84S probably damaging Het
Zranb2 T G 3: 157,546,741 probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 splice site probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 splice site probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
prospector UTSW 10 86901567 splice site probably null
songbird UTSW 10 86858152 missense probably damaging 1.00
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 splice site probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 splice site probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 splice site probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 splice site probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 splice site probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 splice site probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
R7580:Stab2 UTSW 10 86869164 missense probably benign 0.00
R7622:Stab2 UTSW 10 86873902 missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86883782 critical splice donor site probably null
R7658:Stab2 UTSW 10 86981135 missense probably benign 0.12
R7798:Stab2 UTSW 10 86957912 missense probably damaging 0.98
R7835:Stab2 UTSW 10 86872619 missense probably benign 0.06
R7845:Stab2 UTSW 10 86996894 missense probably benign 0.09
R7863:Stab2 UTSW 10 86972881 missense probably benign 0.30
R7885:Stab2 UTSW 10 86878912 missense probably benign 0.03
R7904:Stab2 UTSW 10 86954192 nonsense probably null
R7947:Stab2 UTSW 10 86846033 missense probably benign 0.31
R7963:Stab2 UTSW 10 86848023 critical splice donor site probably null
R8014:Stab2 UTSW 10 86850903 missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86905539 missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86846052 missense probably benign 0.34
R8097:Stab2 UTSW 10 86869095 missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86873864 missense probably damaging 0.98
R8462:Stab2 UTSW 10 86967734 missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86940723 missense probably damaging 1.00
R8692:Stab2 UTSW 10 86972930 missense probably damaging 0.99
R8744:Stab2 UTSW 10 86969349 missense probably benign 0.32
R8745:Stab2 UTSW 10 86969349 missense probably benign 0.32
R8782:Stab2 UTSW 10 86899821 missense probably benign 0.00
R8875:Stab2 UTSW 10 86996864 missense probably damaging 1.00
R8978:Stab2 UTSW 10 86949918 missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86869047 missense probably damaging 1.00
R9248:Stab2 UTSW 10 86891617 missense probably damaging 0.98
R9326:Stab2 UTSW 10 86955146 missense probably damaging 1.00
R9426:Stab2 UTSW 10 86869047 missense probably damaging 1.00
R9568:Stab2 UTSW 10 86863556 missense probably damaging 1.00
R9627:Stab2 UTSW 10 86957840 missense probably damaging 0.98
R9635:Stab2 UTSW 10 86850787 nonsense probably null
R9648:Stab2 UTSW 10 86856697 frame shift probably null
R9649:Stab2 UTSW 10 86856697 frame shift probably null
R9650:Stab2 UTSW 10 86856697 frame shift probably null
R9726:Stab2 UTSW 10 86954231 missense probably benign 0.00
R9756:Stab2 UTSW 10 86967689 missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86922133 missense probably benign 0.03
RF061:Stab2 UTSW 10 86866758 critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86949914 missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86896596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCTAAATCTGCCTGGCAAG -3'
(R):5'- CTCCTCATCTGTGAAATGAAGCG -3'

Sequencing Primer
(F):5'- TGGCAAGCAGCTGTCTC -3'
(R):5'- GCGTTGGGCTATGTACTCTCAAC -3'
Posted On 2016-05-10