Incidental Mutation 'R0347:Zfp959'
ID38486
Institutional Source Beutler Lab
Gene Symbol Zfp959
Ensembl Gene ENSMUSG00000003198
Gene Namezinc finger protein 959
SynonymsBC011426
MMRRC Submission 038554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0347 (G1)
Quality Score158
Status Validated
Chromosome17
Chromosomal Location55892093-55898928 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 55897180 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 69 (Y69*)
Ref Sequence ENSEMBL: ENSMUSP00000153698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054780] [ENSMUST00000224379]
Predicted Effect probably null
Transcript: ENSMUST00000054780
AA Change: Y72*
SMART Domains Protein: ENSMUSP00000053979
Gene: ENSMUSG00000003198
AA Change: Y72*

DomainStartEndE-ValueType
KRAB 4 66 5.28e-14 SMART
ZnF_C2H2 155 177 2.57e2 SMART
ZnF_C2H2 287 309 1.1e-2 SMART
ZnF_C2H2 315 337 4.17e-3 SMART
ZnF_C2H2 343 365 1.47e-3 SMART
ZnF_C2H2 371 393 5.14e-3 SMART
ZnF_C2H2 399 421 1.82e-3 SMART
ZnF_C2H2 427 449 1.98e-4 SMART
ZnF_C2H2 455 477 2.57e-3 SMART
ZnF_C2H2 483 505 7.26e-3 SMART
ZnF_C2H2 511 533 1.72e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224294
Predicted Effect probably null
Transcript: ENSMUST00000224379
AA Change: Y69*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A T 10: 77,984,422 I209F probably damaging Het
5830411N06Rik T A 7: 140,297,854 H800Q probably damaging Het
Abca4 A G 3: 122,120,099 E908G probably benign Het
Abcb5 T A 12: 118,965,251 probably benign Het
Adhfe1 T A 1: 9,553,430 F102Y probably benign Het
Aff4 A G 11: 53,400,088 Y625C probably benign Het
Alox5 T C 6: 116,413,552 E488G possibly damaging Het
Ankmy2 T C 12: 36,193,754 C323R probably damaging Het
Ankrd28 A G 14: 31,702,022 *1084R probably null Het
Apol10a A T 15: 77,488,691 I176F probably damaging Het
Arhgap26 C T 18: 38,617,744 T70I unknown Het
Arid2 A G 15: 96,370,952 N982S probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camsap3 A G 8: 3,602,029 D291G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdc20b G T 13: 113,059,827 G162V probably damaging Het
Cep44 T G 8: 56,545,475 E56A probably damaging Het
Cfap65 A G 1: 74,926,444 L469P probably damaging Het
Cilp T A 9: 65,280,153 C1177S probably benign Het
Ctnnbip1 C T 4: 149,545,754 P7S probably damaging Het
Cyp11a1 T C 9: 58,016,260 probably benign Het
Cyp3a11 C T 5: 145,865,925 V253M possibly damaging Het
D630045J12Rik C A 6: 38,181,392 V1117L probably damaging Het
Dnah7b T A 1: 46,240,944 S2678T probably damaging Het
Dock1 T C 7: 134,763,867 I428T probably damaging Het
Fam83f A G 15: 80,672,257 D114G probably damaging Het
Flt3 T A 5: 147,357,992 N423I probably damaging Het
Fnbp1l A T 3: 122,590,175 F31L probably damaging Het
Glrx3 G A 7: 137,437,701 E10K unknown Het
Gm12185 T C 11: 48,915,182 E394G probably benign Het
Gm15448 A T 7: 3,822,874 V332E probably damaging Het
Gpatch1 C T 7: 35,297,631 V381M probably benign Het
Grm8 T C 6: 27,981,222 S230G probably benign Het
Heyl A T 4: 123,233,940 D25V probably benign Het
Junb G A 8: 84,978,478 probably benign Het
Klhl29 C A 12: 5,084,354 V747F probably damaging Het
Krt77 T C 15: 101,859,869 H569R unknown Het
Ldhb T C 6: 142,494,133 N227S probably benign Het
Megf6 A G 4: 154,254,635 D543G possibly damaging Het
Mrps23 A T 11: 88,210,693 Q136L probably benign Het
Myh2 C T 11: 67,185,304 probably benign Het
Nadk2 T A 15: 9,084,207 D133E probably benign Het
Neurod4 G A 10: 130,271,111 T98I probably damaging Het
Nfatc2 G T 2: 168,536,290 T465K probably damaging Het
Nipbl A G 15: 8,350,732 S859P probably benign Het
Nipsnap3a T C 4: 52,997,155 probably benign Het
Nlrp4c A G 7: 6,066,416 K439E possibly damaging Het
Olfr1419 A T 19: 11,870,433 L261H probably damaging Het
Olfr392 C T 11: 73,814,311 G257D probably damaging Het
Olfr434 T C 6: 43,217,362 F150L probably benign Het
Pds5b T A 5: 150,736,427 probably benign Het
Plch1 A G 3: 63,753,316 M282T probably damaging Het
Plch2 C A 4: 154,986,721 R1067L possibly damaging Het
Pou2f2 A C 7: 25,097,701 F206V probably damaging Het
Prss50 A G 9: 110,862,350 I49V probably damaging Het
Rexo5 T A 7: 119,823,896 probably null Het
Rgl2 C T 17: 33,932,738 T252I probably damaging Het
Rp1l1 A T 14: 64,030,804 K1280* probably null Het
Rpl24 T A 16: 55,970,177 probably null Het
Satb1 T A 17: 51,739,906 K763* probably null Het
Sema6a T A 18: 47,291,129 R237S probably damaging Het
Spg11 T C 2: 122,097,369 T645A probably damaging Het
Srrt T A 5: 137,299,676 probably benign Het
Tanc1 T C 2: 59,842,991 V1480A probably benign Het
Tbc1d2 T C 4: 46,620,574 D412G possibly damaging Het
Tecrl T C 5: 83,294,632 E198G probably damaging Het
Tigd4 A G 3: 84,593,860 D28G probably damaging Het
Trp53bp2 T G 1: 182,441,648 L226V probably benign Het
Ttll13 T C 7: 80,260,505 S799P possibly damaging Het
Vps13c A T 9: 67,910,233 Q1062H possibly damaging Het
Wnt10a T G 1: 74,793,543 H98Q probably damaging Het
Zfp651 C T 9: 121,763,102 P198S probably damaging Het
Znrd1as T A 17: 36,965,315 M114K probably damaging Het
Other mutations in Zfp959
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfp959 APN 17 55897565 missense possibly damaging 0.91
IGL02731:Zfp959 APN 17 55895956 splice site probably benign
IGL03206:Zfp959 APN 17 55897613 missense possibly damaging 0.78
R0141:Zfp959 UTSW 17 55898139 missense probably benign 0.41
R0522:Zfp959 UTSW 17 55896201 missense probably null 1.00
R1692:Zfp959 UTSW 17 55898299 missense probably damaging 0.99
R1771:Zfp959 UTSW 17 55897677 unclassified probably null
R1891:Zfp959 UTSW 17 55897604 missense probably damaging 1.00
R1945:Zfp959 UTSW 17 55897231 nonsense probably null
R1959:Zfp959 UTSW 17 55897404 missense probably damaging 0.98
R2317:Zfp959 UTSW 17 55897326 missense possibly damaging 0.59
R4726:Zfp959 UTSW 17 55898260 unclassified probably null
R4869:Zfp959 UTSW 17 55897228 missense possibly damaging 0.95
R5436:Zfp959 UTSW 17 55897626 missense probably benign
R6235:Zfp959 UTSW 17 55897427 missense probably damaging 1.00
R6365:Zfp959 UTSW 17 55897785 missense probably damaging 1.00
R6391:Zfp959 UTSW 17 55895854 missense probably damaging 1.00
R6417:Zfp959 UTSW 17 55898094 missense probably damaging 1.00
R6420:Zfp959 UTSW 17 55898094 missense probably damaging 1.00
R7114:Zfp959 UTSW 17 55898501 missense possibly damaging 0.94
R7380:Zfp959 UTSW 17 55898551 missense possibly damaging 0.94
R7437:Zfp959 UTSW 17 55898334 missense probably damaging 1.00
R7568:Zfp959 UTSW 17 55897886 missense probably benign 0.01
Z1088:Zfp959 UTSW 17 55898135 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- aacaacaGTCCAGCCACttagttttaca -3'
(R):5'- GGATTTCATTCCCAAATGATTTCtttggtgt -3'

Sequencing Primer
(F):5'- accattcaagtatcagaaaatgcag -3'
(R):5'- gctcacatttatcatttccttttcc -3'
Posted On2013-05-23