Incidental Mutation 'R4982:Malrd1'
ID 384886
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene Name MAM and LDL receptor class A domain containing 1
Synonyms Gm13364, Gm13318, Diet1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 15531290-16260366 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16046940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1689 (T1689A)
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
AlphaFold A2AJX4
Predicted Effect probably benign
Transcript: ENSMUST00000146205
AA Change: T1689A

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: T1689A

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16,146,997 (GRCm39) splice site probably benign
IGL01295:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01296:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01399:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01400:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01401:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01402:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01405:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL01406:Malrd1 APN 2 16,106,768 (GRCm39) critical splice donor site probably null
IGL02105:Malrd1 APN 2 16,132,674 (GRCm39) missense unknown
IGL02581:Malrd1 APN 2 16,147,123 (GRCm39) nonsense probably null
IGL03015:Malrd1 APN 2 16,047,082 (GRCm39) missense unknown
IGL03038:Malrd1 APN 2 16,132,778 (GRCm39) missense unknown
R1353:Malrd1 UTSW 2 16,132,779 (GRCm39) missense unknown
R1385:Malrd1 UTSW 2 16,047,039 (GRCm39) missense unknown
R2242:Malrd1 UTSW 2 16,106,755 (GRCm39) missense unknown
R2888:Malrd1 UTSW 2 16,079,568 (GRCm39) missense unknown
R4398:Malrd1 UTSW 2 16,155,594 (GRCm39) missense unknown
R5148:Malrd1 UTSW 2 16,147,037 (GRCm39) missense unknown
R5195:Malrd1 UTSW 2 16,155,621 (GRCm39) missense unknown
R5828:Malrd1 UTSW 2 15,531,464 (GRCm39) missense probably benign 0.00
R5892:Malrd1 UTSW 2 15,619,078 (GRCm39) missense probably benign 0.03
R6034:Malrd1 UTSW 2 15,850,137 (GRCm39) missense possibly damaging 0.78
R6034:Malrd1 UTSW 2 15,850,137 (GRCm39) missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15,700,137 (GRCm39) missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16,047,078 (GRCm39) missense unknown
R6438:Malrd1 UTSW 2 15,619,017 (GRCm39) missense
R6457:Malrd1 UTSW 2 15,672,740 (GRCm39) missense probably benign 0.41
R6457:Malrd1 UTSW 2 15,531,408 (GRCm39) start gained probably benign
R6499:Malrd1 UTSW 2 15,936,500 (GRCm39) missense probably benign 0.03
R6575:Malrd1 UTSW 2 15,847,439 (GRCm39) missense probably benign 0.00
R6792:Malrd1 UTSW 2 16,155,567 (GRCm39) missense unknown
R6796:Malrd1 UTSW 2 15,874,595 (GRCm39) missense unknown
R6930:Malrd1 UTSW 2 15,802,478 (GRCm39) missense unknown
R6959:Malrd1 UTSW 2 16,222,820 (GRCm39) missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16,155,602 (GRCm39) missense unknown
R7102:Malrd1 UTSW 2 16,147,114 (GRCm39) missense unknown
R7112:Malrd1 UTSW 2 15,929,987 (GRCm39) missense unknown
R7248:Malrd1 UTSW 2 16,106,722 (GRCm39) missense unknown
R7249:Malrd1 UTSW 2 15,628,151 (GRCm39) missense probably damaging 0.97
R7334:Malrd1 UTSW 2 16,011,529 (GRCm39) missense probably damaging 0.99
R7394:Malrd1 UTSW 2 15,700,010 (GRCm39) missense unknown
R7399:Malrd1 UTSW 2 15,614,901 (GRCm39) missense
R7476:Malrd1 UTSW 2 16,147,115 (GRCm39) missense unknown
R7582:Malrd1 UTSW 2 15,700,081 (GRCm39) missense unknown
R7604:Malrd1 UTSW 2 15,930,003 (GRCm39) missense unknown
R7662:Malrd1 UTSW 2 15,876,265 (GRCm39) missense unknown
R7681:Malrd1 UTSW 2 16,222,913 (GRCm39) missense unknown
R7740:Malrd1 UTSW 2 15,619,026 (GRCm39) missense not run
R7747:Malrd1 UTSW 2 16,079,646 (GRCm39) missense unknown
R7754:Malrd1 UTSW 2 15,802,610 (GRCm39) splice site probably null
R7950:Malrd1 UTSW 2 16,132,879 (GRCm39) missense unknown
R8194:Malrd1 UTSW 2 15,929,931 (GRCm39) missense unknown
R8260:Malrd1 UTSW 2 15,619,017 (GRCm39) missense
R8314:Malrd1 UTSW 2 15,757,643 (GRCm39) missense unknown
R8342:Malrd1 UTSW 2 15,638,035 (GRCm39) missense unknown
R8386:Malrd1 UTSW 2 15,701,655 (GRCm39) missense unknown
R8492:Malrd1 UTSW 2 15,614,934 (GRCm39) missense
R8728:Malrd1 UTSW 2 15,701,753 (GRCm39) nonsense probably null
R8756:Malrd1 UTSW 2 15,757,706 (GRCm39) critical splice donor site probably null
R8869:Malrd1 UTSW 2 15,570,368 (GRCm39) critical splice donor site probably null
R8888:Malrd1 UTSW 2 15,850,038 (GRCm39) missense unknown
R8895:Malrd1 UTSW 2 15,850,038 (GRCm39) missense unknown
R8902:Malrd1 UTSW 2 16,260,145 (GRCm39) nonsense probably null
R8954:Malrd1 UTSW 2 15,556,178 (GRCm39) missense
R8960:Malrd1 UTSW 2 15,570,241 (GRCm39) nonsense probably null
R9005:Malrd1 UTSW 2 15,850,140 (GRCm39) missense unknown
R9135:Malrd1 UTSW 2 15,802,516 (GRCm39) missense unknown
R9267:Malrd1 UTSW 2 16,260,077 (GRCm39) missense unknown
R9330:Malrd1 UTSW 2 16,260,089 (GRCm39) missense unknown
R9359:Malrd1 UTSW 2 15,618,988 (GRCm39) missense
R9383:Malrd1 UTSW 2 15,700,012 (GRCm39) missense unknown
R9389:Malrd1 UTSW 2 15,707,967 (GRCm39) missense unknown
R9403:Malrd1 UTSW 2 15,618,988 (GRCm39) missense
R9454:Malrd1 UTSW 2 15,802,537 (GRCm39) nonsense probably null
R9454:Malrd1 UTSW 2 15,757,660 (GRCm39) missense unknown
R9520:Malrd1 UTSW 2 16,079,631 (GRCm39) missense unknown
R9544:Malrd1 UTSW 2 15,640,809 (GRCm39) missense unknown
R9609:Malrd1 UTSW 2 15,700,081 (GRCm39) missense unknown
R9667:Malrd1 UTSW 2 15,570,026 (GRCm39) critical splice acceptor site probably null
R9721:Malrd1 UTSW 2 15,701,638 (GRCm39) missense unknown
R9787:Malrd1 UTSW 2 15,625,401 (GRCm39) missense unknown
R9800:Malrd1 UTSW 2 15,847,405 (GRCm39) missense unknown
Z1176:Malrd1 UTSW 2 16,222,656 (GRCm39) missense unknown
Z1191:Malrd1 UTSW 2 16,047,037 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTGGTTGTACTCTGACCTCC -3'
(R):5'- TTCAGCTGATAGATTTACCTGGTG -3'

Sequencing Primer
(F):5'- TGACCTCCACACACATGCTATGG -3'
(R):5'- GTGTGGTCCGAATCTCTGCTC -3'
Posted On 2016-05-10