Mutagenetix > Incidental Mutations

Incidental Mutation 'R4982:Sec24d'

384896

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4982 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123299606 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 284 (T284M)

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

Predicted Effect

probably benign
Transcript: ENSMUST00000047923
AA Change: T284M

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: T284M

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197291

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,292,348	I1404L	possibly damaging	Het
Adra1b	A	G	11: 43,835,230	S287P	probably damaging	Het
Atxn2	G	T	5: 121,814,343	A1280S	possibly damaging	Het
Bbip1	T	C	19: 53,932,208		probably null	Het
Bbs2	A	G	8: 94,082,354		probably null	Het
Bcl11b	A	T	12: 107,965,772	C180*	probably null	Het
Bod1l	A	G	5: 41,820,473	V1166A	probably benign	Het
Bora	C	T	14: 99,047,352	P13S	probably damaging	Het
C2cd4c	T	C	10: 79,613,241	E24G	probably benign	Het
Ccne1	A	T	7: 38,100,571	I196N	probably damaging	Het
Chsy3	C	T	18: 59,409,575	S595L	probably benign	Het
Chsy3	T	A	18: 59,409,767	I659N	possibly damaging	Het
Cntrob	T	A	11: 69,311,362		probably null	Het
Col5a2	G	A	1: 45,389,458	P983S	possibly damaging	Het
Crat	T	A	2: 30,407,136		probably null	Het
Ctnnbl1	C	T	2: 157,836,553	H359Y	probably benign	Het
D430041D05Rik	A	G	2: 104,255,387	V83A	possibly damaging	Het
Dixdc1	A	G	9: 50,682,602	S488P	possibly damaging	Het
Dmrta1	T	C	4: 89,688,564	C86R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Fam171a1	G	A	2: 3,178,468		probably null	Het
Fam222b	T	C	11: 78,154,743	C249R	probably damaging	Het
Fbxw18	T	A	9: 109,702,651		probably benign	Het
Fes	T	C	7: 80,387,204	Y44C	probably damaging	Het
Gimap6	A	G	6: 48,707,999	V51A	probably benign	Het
Gpr75	C	A	11: 30,891,462	H122Q	probably damaging	Het
Gpr75	C	T	11: 30,891,463	L123F	possibly damaging	Het
Greb1	A	G	12: 16,724,761	S212P	probably damaging	Het
Grin3a	T	C	4: 49,665,512	H1041R	probably benign	Het
Ifna5	A	G	4: 88,835,624	N34D	probably damaging	Het
Ift140	A	T	17: 25,036,994	H221L	probably damaging	Het
Igsf3	T	C	3: 101,435,667	V540A	probably benign	Het
Il10ra	A	G	9: 45,269,059	L5S	probably damaging	Het
Klra2	A	T	6: 131,220,189	D282E	probably benign	Het
Lyst	T	A	13: 13,725,954	H3138Q	probably damaging	Het
Malrd1	A	G	2: 16,042,129	T1689A	probably benign	Het
Mon2	A	T	10: 122,995,789	L1671M	probably damaging	Het
Mpped1	T	C	15: 83,836,327	F71S	probably damaging	Het
Mtpap	C	A	18: 4,396,332	H541Q	probably benign	Het
Muc5ac	T	A	7: 141,809,456		probably benign	Het
Mybbp1a	T	C	11: 72,445,214	I451T	probably damaging	Het
Myh7	T	A	14: 54,972,767	E1827V	probably damaging	Het
Olfr132	A	T	17: 38,130,577	I205N	probably damaging	Het
Olfr145	C	A	9: 37,897,515	T37N	probably damaging	Het
Olfr342	A	T	2: 36,527,397		probably null	Het
Olfr501-ps1	T	A	7: 108,508,648	Y197*	probably null	Het
Os9	C	T	10: 127,121,051	R23H	possibly damaging	Het
Otud6b	A	G	4: 14,815,607	L261P	probably damaging	Het
Pcdhga2	A	G	18: 37,669,423	N107D	probably benign	Het
Pclo	C	T	5: 14,679,294		probably benign	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phtf1	T	A	3: 103,998,708	S524T	probably damaging	Het
Pkdrej	A	C	15: 85,818,996	L913R	probably damaging	Het
Pld1	C	A	3: 28,031,298	A201D	probably damaging	Het
Rorb	T	A	19: 18,977,688	Q103L	probably benign	Het
Serpinb3b	T	C	1: 107,157,754	I86V	probably benign	Het
Serpinb6a	A	T	13: 33,918,874	M201K	probably damaging	Het
Snx8	A	G	5: 140,352,234	S219P	probably benign	Het
Sp8	C	T	12: 118,848,425	T5I	probably damaging	Het
Tanc1	A	G	2: 59,799,943	N749D	probably damaging	Het
Tarm1	G	C	7: 3,489,096	P284A	probably damaging	Het
Tbx15	A	T	3: 99,254,074	E65V	probably benign	Het
Ticam1	T	A	17: 56,272,020	H25L	probably benign	Het
Tmprss11g	T	A	5: 86,492,815	L170F	probably damaging	Het
Tnfsf9	A	G	17: 57,107,504	*310W	probably null	Het
Tsks	C	T	7: 44,943,994	T128I	possibly damaging	Het
Uhrf1bp1	T	C	17: 27,886,606	F702S	probably benign	Het
Vmn1r175	A	T	7: 23,809,069	N44K	possibly damaging	Het
Vmn1r45	A	G	6: 89,933,865	I41T	probably damaging	Het
Ythdc2	A	G	18: 44,871,465	N1102S	probably benign	Het
Zswim4	C	T	8: 84,226,667		probably null	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGCTAGATTGATTTCTCTGAGG -3'
(R):5'- GGAGGCTAATAGGAAACTGATCTC -3'

Sequencing Primer
(F):5'- AGGATTTGTAAAGGACCCTTCTC -3'
(R):5'- GGCTAATAGGAAACTGATCTCTTCTC -3'

Posted On

2016-05-10