Incidental Mutation 'R4982:Grin3a'
ID384900
Institutional Source Beutler Lab
Gene Symbol Grin3a
Ensembl Gene ENSMUSG00000039579
Gene Nameglutamate receptor ionotropic, NMDA3A
SynonymsNR3A, A830097C19Rik, NMDAR-L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4982 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49661611-49845744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49665512 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1041 (H1041R)
Ref Sequence ENSEMBL: ENSMUSP00000091381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076674] [ENSMUST00000093859]
Predicted Effect probably benign
Transcript: ENSMUST00000076674
AA Change: H1021R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579
AA Change: H1021R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1063 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093859
AA Change: H1041R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579
AA Change: H1041R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1083 1125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased current densities in some cerebrocortical neurons of the brain, increased levels of prepulse inhibition, and altered dendritic spine morphology. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Grin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Grin3a APN 4 49770589 missense probably damaging 1.00
IGL01541:Grin3a APN 4 49792533 missense probably damaging 0.98
IGL01886:Grin3a APN 4 49702814 missense probably damaging 1.00
IGL02133:Grin3a APN 4 49792946 nonsense probably null
IGL02367:Grin3a APN 4 49702805 missense probably damaging 1.00
IGL02481:Grin3a APN 4 49702868 missense probably damaging 1.00
IGL02830:Grin3a APN 4 49702787 missense possibly damaging 0.94
IGL02945:Grin3a APN 4 49792971 missense possibly damaging 0.86
IGL03174:Grin3a APN 4 49771107 missense probably damaging 1.00
R0266:Grin3a UTSW 4 49665501 nonsense probably null
R0597:Grin3a UTSW 4 49665351 missense probably damaging 1.00
R0849:Grin3a UTSW 4 49665501 nonsense probably null
R1448:Grin3a UTSW 4 49702804 missense probably damaging 1.00
R1640:Grin3a UTSW 4 49844721 missense probably benign
R1751:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1767:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1858:Grin3a UTSW 4 49792437 missense probably benign 0.01
R1860:Grin3a UTSW 4 49665309 missense possibly damaging 0.95
R1924:Grin3a UTSW 4 49844988 missense possibly damaging 0.95
R2035:Grin3a UTSW 4 49771336 missense probably damaging 1.00
R2108:Grin3a UTSW 4 49665510 missense possibly damaging 0.91
R2307:Grin3a UTSW 4 49793033 critical splice acceptor site probably null
R3082:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3083:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3430:Grin3a UTSW 4 49792534 missense probably benign 0.01
R3695:Grin3a UTSW 4 49792704 missense possibly damaging 0.81
R3932:Grin3a UTSW 4 49672472 critical splice donor site probably null
R4559:Grin3a UTSW 4 49844555 missense probably damaging 1.00
R4972:Grin3a UTSW 4 49770484 missense probably damaging 1.00
R5385:Grin3a UTSW 4 49719313 missense probably damaging 1.00
R5423:Grin3a UTSW 4 49770376 intron probably benign
R5478:Grin3a UTSW 4 49792481 missense probably benign 0.00
R5634:Grin3a UTSW 4 49792843 missense probably damaging 1.00
R5790:Grin3a UTSW 4 49792717 missense probably damaging 1.00
R5976:Grin3a UTSW 4 49792602 missense probably damaging 1.00
R6271:Grin3a UTSW 4 49792516 missense probably benign 0.00
R6451:Grin3a UTSW 4 49844969 missense probably damaging 1.00
R6538:Grin3a UTSW 4 49770856 missense probably damaging 1.00
R6629:Grin3a UTSW 4 49844991 missense probably damaging 1.00
R7217:Grin3a UTSW 4 49770741 missense possibly damaging 0.81
R7337:Grin3a UTSW 4 49702762 missense probably damaging 1.00
R7338:Grin3a UTSW 4 49771238 missense probably benign
R7477:Grin3a UTSW 4 49719278 missense probably damaging 1.00
Z1176:Grin3a UTSW 4 49770622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGCATCACGGAGTTC -3'
(R):5'- CTTCAACTAAGTCCATGGCTCC -3'

Sequencing Primer
(F):5'- TCCGAGCTACATTGAGGGAGTC -3'
(R):5'- AGCAGGTAGTCCATTCATGAC -3'
Posted On2016-05-10