Incidental Mutation 'R4982:Tmprss11g'
ID 384906
Institutional Source Beutler Lab
Gene Symbol Tmprss11g
Ensembl Gene ENSMUSG00000079451
Gene Name transmembrane protease, serine 11g
Synonyms Desc4, 9930032O22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 86485876-86518600 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86492815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 170 (L170F)
Ref Sequence ENSEMBL: ENSMUSP00000122709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134179] [ENSMUST00000140095]
AlphaFold Q8BZ10
Predicted Effect probably damaging
Transcript: ENSMUST00000134179
AA Change: L170F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122709
Gene: ENSMUSG00000079451
AA Change: L170F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:SEA 48 150 1.5e-25 PFAM
Tryp_SPc 185 411 1.39e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140095
SMART Domains Protein: ENSMUSP00000115540
Gene: ENSMUSG00000079451

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:SEA 45 154 1.3e-19 PFAM
Tryp_SPc 172 398 1.39e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199703
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Tmprss11g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tmprss11g APN 5 86492191 missense probably benign 0.00
IGL01611:Tmprss11g APN 5 86490781 missense probably benign 0.02
IGL02417:Tmprss11g APN 5 86490891 missense probably benign 0.25
IGL02677:Tmprss11g APN 5 86492290 missense probably benign
IGL02832:Tmprss11g APN 5 86497269 missense probably benign 0.23
IGL02887:Tmprss11g APN 5 86497329 splice site probably benign
R0377:Tmprss11g UTSW 5 86490751 missense probably damaging 0.98
R0847:Tmprss11g UTSW 5 86490726 missense probably benign 0.01
R1037:Tmprss11g UTSW 5 86490747 missense probably damaging 1.00
R1507:Tmprss11g UTSW 5 86499611 missense probably benign 0.09
R1617:Tmprss11g UTSW 5 86499563 missense probably damaging 0.99
R1955:Tmprss11g UTSW 5 86498532 missense probably damaging 0.99
R2094:Tmprss11g UTSW 5 86499556 missense probably damaging 1.00
R2906:Tmprss11g UTSW 5 86492802 intron probably benign
R4730:Tmprss11g UTSW 5 86489232 nonsense probably null
R4730:Tmprss11g UTSW 5 86489233 missense probably damaging 1.00
R4934:Tmprss11g UTSW 5 86496542 missense probably benign
R5086:Tmprss11g UTSW 5 86496518 missense possibly damaging 0.65
R5606:Tmprss11g UTSW 5 86487410 missense probably damaging 1.00
R5825:Tmprss11g UTSW 5 86498533 missense probably damaging 0.98
R6291:Tmprss11g UTSW 5 86487422 missense probably damaging 1.00
R6481:Tmprss11g UTSW 5 86492156 missense probably benign 0.20
R6849:Tmprss11g UTSW 5 86496632 missense probably benign 0.01
R6925:Tmprss11g UTSW 5 86487426 missense probably benign 0.09
R6925:Tmprss11g UTSW 5 86487436 missense probably benign 0.00
R7084:Tmprss11g UTSW 5 86492200 missense probably damaging 1.00
R7089:Tmprss11g UTSW 5 86489291 missense probably damaging 0.97
R7190:Tmprss11g UTSW 5 86496632 missense probably benign 0.18
R7352:Tmprss11g UTSW 5 86496542 missense not run
R7432:Tmprss11g UTSW 5 86496507 missense possibly damaging 0.71
R7514:Tmprss11g UTSW 5 86497317 missense probably damaging 1.00
R8198:Tmprss11g UTSW 5 86498493 missense probably benign
R8490:Tmprss11g UTSW 5 86492117 critical splice donor site probably null
R8495:Tmprss11g UTSW 5 86492260 missense probably benign 0.07
R8706:Tmprss11g UTSW 5 86496545 missense probably damaging 1.00
R8730:Tmprss11g UTSW 5 86490978 critical splice acceptor site probably null
R9158:Tmprss11g UTSW 5 86489307 missense probably damaging 1.00
R9224:Tmprss11g UTSW 5 86492144 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATCAGCGATTCTTGCTATGGG -3'
(R):5'- TGGTTCCAACTCGATGTCCC -3'

Sequencing Primer
(F):5'- CCTCAAGCTTTACTGCAGAGCAATTG -3'
(R):5'- AACTCGATGTCCCTTGCTTATG -3'
Posted On 2016-05-10