Incidental Mutation 'R4982:Atxn2'
ID 384907
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 121952406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1280 (A1280S)
Ref Sequence ENSEMBL: ENSMUSP00000056715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040308] [ENSMUST00000051950] [ENSMUST00000086310] [ENSMUST00000118580] [ENSMUST00000122426] [ENSMUST00000136960] [ENSMUST00000160220] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000162327] [ENSMUST00000161159] [ENSMUST00000197892]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040308
SMART Domains Protein: ENSMUSP00000041611
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 23 76 1.1e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000051950
AA Change: A1280S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: A1280S

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086310
SMART Domains Protein: ENSMUSP00000083490
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118580
SMART Domains Protein: ENSMUSP00000113808
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 4.1e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 324 409 3.53e-19 SMART
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122426
SMART Domains Protein: ENSMUSP00000113926
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136960
SMART Domains Protein: ENSMUSP00000119086
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2.4e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect probably benign
Transcript: ENSMUST00000160220
SMART Domains Protein: ENSMUSP00000124059
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161064
AA Change: K896N

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605
AA Change: K896N

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162327
AA Change: A656S

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605
AA Change: A656S

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161159
AA Change: K201N

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605
AA Change: K201N

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162459
Predicted Effect probably benign
Transcript: ENSMUST00000198161
Predicted Effect probably benign
Transcript: ENSMUST00000197892
SMART Domains Protein: ENSMUSP00000142666
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 6.3e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
Blast:PH 168 250 3e-53 BLAST
PDB:1V5M|A 171 250 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199864
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGACTTGTATCTGAAGTGG -3'
(R):5'- ACTGCAAGTGAGCTGTTAGC -3'

Sequencing Primer
(F):5'- ATCTGAAGTGGTTTACGTCTGAC -3'
(R):5'- GCTGTTAGCATTCCTATCAGATG -3'
Posted On 2016-05-10