Mutagenetix > Incidental Mutation

Incidental Mutation 'R4982:Atxn2'

384907

Institutional Source

Beutler Lab

Gene Symbol

Atxn2

Ensembl Gene

ENSMUSG00000042605

Gene Name

ataxin 2

Synonyms

9630045M23Rik, ATX2, Sca2

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.653) question?

Stock #

R4982 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121711337-121816493 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 121814343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 1280 (A1280S)

Ref Sequence

ENSEMBL: ENSMUSP00000056715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040308] [ENSMUST00000051950] [ENSMUST00000086310] [ENSMUST00000118580] [ENSMUST00000122426] [ENSMUST00000136960] [ENSMUST00000160220] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327] [ENSMUST00000197892]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000040308

SMART Domains

Protein: ENSMUSP00000041611
Gene: ENSMUSG00000042594

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Pfam:Phe_ZIP	23	76	1.1e-20	PFAM
low complexity region	114	128	N/A	INTRINSIC
PH	168	281	1.2e-2	SMART
SH2	334	419	3.53e-19	SMART
low complexity region	512	525	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051950
AA Change: A1280S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: A1280S

Domain	Start	End	E-Value	Type
low complexity region	32	42	N/A	INTRINSIC
low complexity region	46	69	N/A	INTRINSIC
low complexity region	93	116	N/A	INTRINSIC
low complexity region	128	144	N/A	INTRINSIC
low complexity region	168	219	N/A	INTRINSIC
Pfam:SM-ATX	236	307	6.4e-23	PFAM
LsmAD	378	446	8.57e-25	SMART
low complexity region	520	540	N/A	INTRINSIC
low complexity region	544	576	N/A	INTRINSIC
low complexity region	685	705	N/A	INTRINSIC
low complexity region	807	838	N/A	INTRINSIC
low complexity region	864	879	N/A	INTRINSIC
Pfam:PAM2	880	897	5.7e-9	PFAM
low complexity region	1128	1165	N/A	INTRINSIC
low complexity region	1185	1196	N/A	INTRINSIC
low complexity region	1245	1261	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086310

SMART Domains

Protein: ENSMUSP00000083490
Gene: ENSMUSG00000042594

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Pfam:Phe_ZIP	22	77	2e-22	PFAM
low complexity region	114	128	N/A	INTRINSIC
PH	168	281	1.2e-2	SMART
SH2	334	419	3.53e-19	SMART
low complexity region	512	525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118580

SMART Domains

Protein: ENSMUSP00000113808
Gene: ENSMUSG00000042594

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Pfam:Phe_ZIP	22	77	4.1e-23	PFAM
low complexity region	114	128	N/A	INTRINSIC
PH	168	281	1.2e-2	SMART
SH2	324	409	3.53e-19	SMART
low complexity region	502	515	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122426

SMART Domains

Protein: ENSMUSP00000113926
Gene: ENSMUSG00000042594

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Pfam:Phe_ZIP	22	77	2e-22	PFAM
low complexity region	114	128	N/A	INTRINSIC
PH	168	281	1.2e-2	SMART
SH2	334	419	3.53e-19	SMART
low complexity region	512	525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136960

SMART Domains

Protein: ENSMUSP00000119086
Gene: ENSMUSG00000042594

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Pfam:Phe_ZIP	22	77	2.4e-23	PFAM
low complexity region	114	128	N/A	INTRINSIC
PH	168	281	1.2e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159928

Predicted Effect

probably benign
Transcript: ENSMUST00000160220

SMART Domains

Protein: ENSMUSP00000124059
Gene: ENSMUSG00000042605

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160462

SMART Domains

Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

Domain	Start	End	E-Value	Type
low complexity region	42	52	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161064
AA Change: K896N

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605
AA Change: K896N

Domain	Start	End	E-Value	Type
LsmAD	69	137	8.57e-25	SMART
low complexity region	211	231	N/A	INTRINSIC
low complexity region	235	267	N/A	INTRINSIC
low complexity region	376	396	N/A	INTRINSIC
low complexity region	498	529	N/A	INTRINSIC
low complexity region	555	570	N/A	INTRINSIC
Pfam:PAM2	571	588	3.5e-9	PFAM
low complexity region	801	838	N/A	INTRINSIC
low complexity region	858	869	N/A	INTRINSIC
low complexity region	915	923	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161159
AA Change: K201N

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605
AA Change: K201N

Domain	Start	End	E-Value	Type
low complexity region	74	111	N/A	INTRINSIC
low complexity region	131	142	N/A	INTRINSIC
low complexity region	188	196	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161433

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161836

Predicted Effect

probably benign
Transcript: ENSMUST00000162327
AA Change: A656S

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605
AA Change: A656S

Domain	Start	End	E-Value	Type
low complexity region	1	32	N/A	INTRINSIC
low complexity region	58	73	N/A	INTRINSIC
Pfam:PAM2	74	91	1.3e-9	PFAM
low complexity region	302	339	N/A	INTRINSIC
low complexity region	359	370	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162459

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183860

Predicted Effect

probably benign
Transcript: ENSMUST00000198161

Predicted Effect

probably benign
Transcript: ENSMUST00000197892

SMART Domains

Protein: ENSMUSP00000142666
Gene: ENSMUSG00000042594

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Pfam:Phe_ZIP	22	77	6.3e-20	PFAM
low complexity region	114	128	N/A	INTRINSIC
Blast:PH	168	250	3e-53	BLAST
PDB:1V5M\|A	171	250	1e-12	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199864

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,292,348	I1404L	possibly damaging	Het
Adra1b	A	G	11: 43,835,230	S287P	probably damaging	Het
Bbip1	T	C	19: 53,932,208		probably null	Het
Bbs2	A	G	8: 94,082,354		probably null	Het
Bcl11b	A	T	12: 107,965,772	C180*	probably null	Het
Bod1l	A	G	5: 41,820,473	V1166A	probably benign	Het
Bora	C	T	14: 99,047,352	P13S	probably damaging	Het
C2cd4c	T	C	10: 79,613,241	E24G	probably benign	Het
Ccne1	A	T	7: 38,100,571	I196N	probably damaging	Het
Chsy3	C	T	18: 59,409,575	S595L	probably benign	Het
Chsy3	T	A	18: 59,409,767	I659N	possibly damaging	Het
Cntrob	T	A	11: 69,311,362		probably null	Het
Col5a2	G	A	1: 45,389,458	P983S	possibly damaging	Het
Crat	T	A	2: 30,407,136		probably null	Het
Ctnnbl1	C	T	2: 157,836,553	H359Y	probably benign	Het
D430041D05Rik	A	G	2: 104,255,387	V83A	possibly damaging	Het
Dixdc1	A	G	9: 50,682,602	S488P	possibly damaging	Het
Dmrta1	T	C	4: 89,688,564	C86R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Fam171a1	G	A	2: 3,178,468		probably null	Het
Fam222b	T	C	11: 78,154,743	C249R	probably damaging	Het
Fbxw18	T	A	9: 109,702,651		probably benign	Het
Fes	T	C	7: 80,387,204	Y44C	probably damaging	Het
Gimap6	A	G	6: 48,707,999	V51A	probably benign	Het
Gpr75	C	A	11: 30,891,462	H122Q	probably damaging	Het
Gpr75	C	T	11: 30,891,463	L123F	possibly damaging	Het
Greb1	A	G	12: 16,724,761	S212P	probably damaging	Het
Grin3a	T	C	4: 49,665,512	H1041R	probably benign	Het
Ifna5	A	G	4: 88,835,624	N34D	probably damaging	Het
Ift140	A	T	17: 25,036,994	H221L	probably damaging	Het
Igsf3	T	C	3: 101,435,667	V540A	probably benign	Het
Il10ra	A	G	9: 45,269,059	L5S	probably damaging	Het
Klra2	A	T	6: 131,220,189	D282E	probably benign	Het
Lyst	T	A	13: 13,725,954	H3138Q	probably damaging	Het
Malrd1	A	G	2: 16,042,129	T1689A	probably benign	Het
Mon2	A	T	10: 122,995,789	L1671M	probably damaging	Het
Mpped1	T	C	15: 83,836,327	F71S	probably damaging	Het
Mtpap	C	A	18: 4,396,332	H541Q	probably benign	Het
Muc5ac	T	A	7: 141,809,456		probably benign	Het
Mybbp1a	T	C	11: 72,445,214	I451T	probably damaging	Het
Myh7	T	A	14: 54,972,767	E1827V	probably damaging	Het
Olfr132	A	T	17: 38,130,577	I205N	probably damaging	Het
Olfr145	C	A	9: 37,897,515	T37N	probably damaging	Het
Olfr342	A	T	2: 36,527,397		probably null	Het
Olfr501-ps1	T	A	7: 108,508,648	Y197*	probably null	Het
Os9	C	T	10: 127,121,051	R23H	possibly damaging	Het
Otud6b	A	G	4: 14,815,607	L261P	probably damaging	Het
Pcdhga2	A	G	18: 37,669,423	N107D	probably benign	Het
Pclo	C	T	5: 14,679,294		probably benign	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phtf1	T	A	3: 103,998,708	S524T	probably damaging	Het
Pkdrej	A	C	15: 85,818,996	L913R	probably damaging	Het
Pld1	C	A	3: 28,031,298	A201D	probably damaging	Het
Rorb	T	A	19: 18,977,688	Q103L	probably benign	Het
Sec24d	C	T	3: 123,299,606	T284M	probably benign	Het
Serpinb3b	T	C	1: 107,157,754	I86V	probably benign	Het
Serpinb6a	A	T	13: 33,918,874	M201K	probably damaging	Het
Snx8	A	G	5: 140,352,234	S219P	probably benign	Het
Sp8	C	T	12: 118,848,425	T5I	probably damaging	Het
Tanc1	A	G	2: 59,799,943	N749D	probably damaging	Het
Tarm1	G	C	7: 3,489,096	P284A	probably damaging	Het
Tbx15	A	T	3: 99,254,074	E65V	probably benign	Het
Ticam1	T	A	17: 56,272,020	H25L	probably benign	Het
Tmprss11g	T	A	5: 86,492,815	L170F	probably damaging	Het
Tnfsf9	A	G	17: 57,107,504	*310W	probably null	Het
Tsks	C	T	7: 44,943,994	T128I	possibly damaging	Het
Uhrf1bp1	T	C	17: 27,886,606	F702S	probably benign	Het
Vmn1r175	A	T	7: 23,809,069	N44K	possibly damaging	Het
Vmn1r45	A	G	6: 89,933,865	I41T	probably damaging	Het
Ythdc2	A	G	18: 44,871,465	N1102S	probably benign	Het
Zswim4	C	T	8: 84,226,667		probably null	Het

Other mutations in Atxn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Atxn2	APN	5	121795055	missense	probably benign	0.00
IGL00798:Atxn2	APN	5	121795235	missense	possibly damaging	0.58
IGL01518:Atxn2	APN	5	121810979	missense	probably damaging	1.00
IGL01737:Atxn2	APN	5	121797344	missense	probably damaging	0.98
IGL01832:Atxn2	APN	5	121806268	nonsense	probably null
IGL02122:Atxn2	APN	5	121778030	missense	probably damaging	1.00
IGL02333:Atxn2	APN	5	121781387	missense	probably damaging	1.00
IGL02742:Atxn2	APN	5	121781336	missense	possibly damaging	0.75
IGL03028:Atxn2	APN	5	121810909	missense	probably damaging	1.00
IGL03282:Atxn2	APN	5	121785235	missense	probably benign	0.00
R0387:Atxn2	UTSW	5	121802143	missense	possibly damaging	0.83
R0653:Atxn2	UTSW	5	121772778	missense	probably damaging	0.99
R0849:Atxn2	UTSW	5	121747421	splice site	probably null
R1305:Atxn2	UTSW	5	121749184	missense	probably damaging	1.00
R1440:Atxn2	UTSW	5	121803082	critical splice donor site	probably null
R1471:Atxn2	UTSW	5	121786374	missense	probably damaging	1.00
R1521:Atxn2	UTSW	5	121779591	missense	probably damaging	1.00
R1528:Atxn2	UTSW	5	121802108	missense	probably damaging	0.99
R1528:Atxn2	UTSW	5	121813530	missense	probably damaging	1.00
R2083:Atxn2	UTSW	5	121784006	missense	probably benign	0.00
R2197:Atxn2	UTSW	5	121806217	splice site	probably null
R2217:Atxn2	UTSW	5	121803077	missense	probably damaging	1.00
R2218:Atxn2	UTSW	5	121803077	missense	probably damaging	1.00
R2420:Atxn2	UTSW	5	121802079	critical splice acceptor site	probably null
R2421:Atxn2	UTSW	5	121802079	critical splice acceptor site	probably null
R2510:Atxn2	UTSW	5	121781393	missense	probably damaging	1.00
R3706:Atxn2	UTSW	5	121785868	critical splice donor site	probably null
R4604:Atxn2	UTSW	5	121781343	missense	probably damaging	1.00
R4852:Atxn2	UTSW	5	121814411	missense	probably damaging	0.97
R4914:Atxn2	UTSW	5	121749096	missense	probably damaging	1.00
R5172:Atxn2	UTSW	5	121795035	splice site	probably null
R5213:Atxn2	UTSW	5	121814480	splice site	probably null
R5655:Atxn2	UTSW	5	121747426	missense	probably damaging	0.97
R5775:Atxn2	UTSW	5	121813449	missense	probably damaging	1.00
R5782:Atxn2	UTSW	5	121797310	missense	probably damaging	1.00
R6015:Atxn2	UTSW	5	121810992	missense	probably damaging	1.00
R6438:Atxn2	UTSW	5	121779432	missense	probably damaging	1.00
R6529:Atxn2	UTSW	5	121811614	critical splice donor site	probably null
R6659:Atxn2	UTSW	5	121777964	missense	probably benign	0.10
R6864:Atxn2	UTSW	5	121779494	missense	probably damaging	1.00
R7035:Atxn2	UTSW	5	121811467	nonsense	probably null
R7166:Atxn2	UTSW	5	121796397	missense	possibly damaging	0.90
R7253:Atxn2	UTSW	5	121778021	missense	probably damaging	1.00
R7257:Atxn2	UTSW	5	121785817	missense	possibly damaging	0.62
R7467:Atxn2	UTSW	5	121802267	critical splice donor site	probably null
R7544:Atxn2	UTSW	5	121781368	missense	probably damaging	1.00
R7648:Atxn2	UTSW	5	121796377	missense	probably damaging	0.99
R7883:Atxn2	UTSW	5	121802117	missense	possibly damaging	0.79
R8097:Atxn2	UTSW	5	121749223	missense	probably damaging	1.00
R8784:Atxn2	UTSW	5	121795028	missense	probably benign	0.00
R8835:Atxn2	UTSW	5	121802185	missense	possibly damaging	0.63
R8880:Atxn2	UTSW	5	121810910	missense	probably benign	0.24
R8983:Atxn2	UTSW	5	121778000	missense	probably damaging	1.00
R9254:Atxn2	UTSW	5	121747446	missense	probably damaging	1.00
R9332:Atxn2	UTSW	5	121785362	missense	probably damaging	1.00
R9379:Atxn2	UTSW	5	121747446	missense	probably damaging	1.00
R9412:Atxn2	UTSW	5	121802138	missense	possibly damaging	0.84
R9649:Atxn2	UTSW	5	121810992	missense	probably damaging	0.98
R9656:Atxn2	UTSW	5	121783998	missense	possibly damaging	0.78
X0028:Atxn2	UTSW	5	121802083	missense	probably benign	0.01
Z1176:Atxn2	UTSW	5	121777990	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGGACTTGTATCTGAAGTGG -3'
(R):5'- ACTGCAAGTGAGCTGTTAGC -3'

Sequencing Primer
(F):5'- ATCTGAAGTGGTTTACGTCTGAC -3'
(R):5'- GCTGTTAGCATTCCTATCAGATG -3'

Posted On

2016-05-10