Mutagenetix > Incidental Mutation

Incidental Mutation 'R0374:Slc9a2'

38491

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

038580-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R0374 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40743857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 427 (F427S)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231]

AlphaFold

Q3ZAS0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027231
AA Change: F427S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: F427S

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Meta Mutation Damage Score

0.1220

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	T	A	7: 140,248,961	C178S	probably damaging	Het
Ano9	A	G	7: 141,107,814	I267T	probably damaging	Het
Anxa6	T	A	11: 55,005,828	N168I	probably benign	Het
Apbb1ip	A	G	2: 22,819,705		probably benign	Het
Aqr	G	A	2: 114,130,611	H723Y	probably damaging	Het
Bbx	C	T	16: 50,280,392	E47K	probably benign	Het
Car13	A	G	3: 14,656,297		probably benign	Het
Casp9	T	A	4: 141,807,173	I298N	possibly damaging	Het
Ccdc66	T	C	14: 27,498,473	E261G	probably damaging	Het
Cep192	T	A	18: 67,818,883	Y376*	probably null	Het
Cped1	T	A	6: 22,222,546		probably benign	Het
Ctbp2	A	T	7: 132,999,344	S563R	possibly damaging	Het
Ctdp1	A	G	18: 80,447,422		probably null	Het
Dgka	G	C	10: 128,721,083		probably benign	Het
Drd2	A	G	9: 49,399,784	T112A	probably benign	Het
Dusp1	A	G	17: 26,508,169	V52A	probably damaging	Het
Eea1	T	A	10: 96,039,772		probably benign	Het
Etfrf1	T	C	6: 145,215,562	V86A	probably benign	Het
Fbn1	A	T	2: 125,321,676	C2087S	possibly damaging	Het
Fosb	T	G	7: 19,307,150	R139S	probably damaging	Het
Foxm1	C	T	6: 128,372,603	R362W	probably damaging	Het
Frem2	A	G	3: 53,653,960	V1042A	probably damaging	Het
Gbe1	A	G	16: 70,483,914	H401R	probably benign	Het
Gm10549	C	T	18: 33,464,182		probably benign	Het
Golga7b	A	T	19: 42,263,319		probably benign	Het
H2-DMb1	T	C	17: 34,159,425	V235A	probably benign	Het
Hr	A	G	14: 70,556,476	T59A	probably benign	Het
Itpr2	C	A	6: 146,359,392	A588S	probably benign	Het
Kmt2c	G	A	5: 25,309,708	P3046S	probably damaging	Het
Lamc1	G	A	1: 153,251,065		probably benign	Het
Lrp2	A	G	2: 69,430,307	Y4527H	probably damaging	Het
Map3k2	G	A	18: 32,212,173		probably null	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Nfs1	C	G	2: 156,132,660	G212R	probably damaging	Het
Nol8	C	T	13: 49,662,447	A677V	possibly damaging	Het
Nrap	T	A	19: 56,351,622	Y740F	probably damaging	Het
Nup205	T	A	6: 35,208,837	M859K	probably damaging	Het
Nxf1	T	C	19: 8,767,739	F451S	possibly damaging	Het
Olfr262	A	T	19: 12,241,141	N173K	probably damaging	Het
Olfr804	G	A	10: 129,705,647	M256I	probably benign	Het
Pcdhac2	T	C	18: 37,145,667	Y567H	probably damaging	Het
Phlpp2	C	T	8: 109,907,513	R242W	probably damaging	Het
Pi4ka	A	G	16: 17,282,932		probably benign	Het
Pmpcb	A	G	5: 21,748,831	D359G	probably damaging	Het
Poll	T	G	19: 45,557,870	S244R	probably benign	Het
Prkd3	T	C	17: 78,957,215	D657G	probably null	Het
Prune2	G	A	19: 17,120,910	M1259I	probably benign	Het
Ptpra	T	A	2: 130,537,621	M329K	probably damaging	Het
Rbm10	GGGAGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG	GGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG	X: 20,637,559		probably benign	Het
Rbm15	G	T	3: 107,330,564	D839E	probably damaging	Het
Sap30bp	T	A	11: 115,964,277	I271N	probably damaging	Het
Scn3a	A	T	2: 65,508,574	V587E	probably damaging	Het
Setdb1	A	T	3: 95,324,853		probably benign	Het
Sgk3	T	A	1: 9,879,081		probably null	Het
Shox2	A	T	3: 66,973,851	H265Q	probably damaging	Het
Smarca5	T	A	8: 80,736,731	Q69H	probably benign	Het
Specc1l	T	A	10: 75,248,459	F672Y	probably damaging	Het
Ssh2	T	A	11: 77,408,143	S105R	probably damaging	Het
Syne2	C	T	12: 75,921,226	R917*	probably null	Het
Tbc1d2	G	A	4: 46,649,913	T41M	possibly damaging	Het
Tbx18	T	A	9: 87,724,355	I246F	probably damaging	Het
Tcf4	T	A	18: 69,681,812		probably benign	Het
Tmed2	C	A	5: 124,541,439		probably null	Het
Tmem243	A	T	5: 9,101,361	D15V	possibly damaging	Het
Vmn2r87	T	A	10: 130,471,979	S797C	probably damaging	Het
Vps13c	T	A	9: 67,886,246		probably benign	Het
Wls	T	A	3: 159,897,437	C162*	probably null	Het
Zbtb7c	C	T	18: 76,137,393	T184I	probably benign	Het
Zc3h13	A	G	14: 75,308,965	K169E	probably damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAGTCCCCAGTGTTTGCAGTTC -3'
(R):5'- TTCCCTCTGTGAGACCAAGTGACC -3'

Sequencing Primer
(F):5'- TGCAGTTCAGGGGTCCAG -3'
(R):5'- TTGCACATCTCCTGCTAAAGAGAG -3'

Posted On

2013-05-23