Incidental Mutation 'R4982:Vmn1r45'
ID 384910
Institutional Source Beutler Lab
Gene Symbol Vmn1r45
Ensembl Gene ENSMUSG00000044248
Gene Name vomeronasal 1 receptor 45
Synonyms V1ra2, V1r2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 89908632-89917489 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89910847 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 41 (I41T)
Ref Sequence ENSEMBL: ENSMUSP00000154795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054202] [ENSMUST00000226167] [ENSMUST00000227122] [ENSMUST00000227426] [ENSMUST00000227571] [ENSMUST00000227977] [ENSMUST00000228662] [ENSMUST00000228492]
AlphaFold Q8VIC7
Predicted Effect probably damaging
Transcript: ENSMUST00000054202
AA Change: I41T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052123
Gene: ENSMUSG00000044248
AA Change: I41T

DomainStartEndE-ValueType
Pfam:TAS2R 26 315 2.5e-10 PFAM
Pfam:V1R 54 318 1.5e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226167
Predicted Effect probably benign
Transcript: ENSMUST00000227122
Predicted Effect probably damaging
Transcript: ENSMUST00000227426
AA Change: I41T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000227571
Predicted Effect probably damaging
Transcript: ENSMUST00000227977
AA Change: I41T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000228662
AA Change: I41T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000228492
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Vmn1r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Vmn1r45 APN 6 89,910,646 (GRCm39) missense probably damaging 1.00
IGL02010:Vmn1r45 APN 6 89,910,668 (GRCm39) missense probably damaging 1.00
IGL02124:Vmn1r45 APN 6 89,910,035 (GRCm39) missense probably benign 0.03
IGL02413:Vmn1r45 APN 6 89,910,503 (GRCm39) missense possibly damaging 0.75
R0123:Vmn1r45 UTSW 6 89,910,492 (GRCm39) nonsense probably null
R0225:Vmn1r45 UTSW 6 89,910,492 (GRCm39) nonsense probably null
R1513:Vmn1r45 UTSW 6 89,910,058 (GRCm39) missense probably damaging 0.97
R2154:Vmn1r45 UTSW 6 89,910,965 (GRCm39) missense possibly damaging 0.91
R3082:Vmn1r45 UTSW 6 89,910,724 (GRCm39) missense probably benign 0.03
R3781:Vmn1r45 UTSW 6 89,910,799 (GRCm39) missense probably benign
R5086:Vmn1r45 UTSW 6 89,910,082 (GRCm39) missense probably benign 0.06
R5327:Vmn1r45 UTSW 6 89,910,123 (GRCm39) missense possibly damaging 0.79
R5470:Vmn1r45 UTSW 6 89,910,698 (GRCm39) missense probably benign 0.04
R6681:Vmn1r45 UTSW 6 89,910,985 (GRCm39) start gained probably benign
R7046:Vmn1r45 UTSW 6 89,910,538 (GRCm39) missense probably benign 0.00
R7050:Vmn1r45 UTSW 6 89,910,703 (GRCm39) missense probably damaging 0.97
R7171:Vmn1r45 UTSW 6 89,910,316 (GRCm39) missense probably damaging 1.00
R7236:Vmn1r45 UTSW 6 89,910,133 (GRCm39) missense probably benign 0.15
R7401:Vmn1r45 UTSW 6 89,910,416 (GRCm39) missense possibly damaging 0.64
R7417:Vmn1r45 UTSW 6 89,910,035 (GRCm39) missense probably benign 0.03
R8068:Vmn1r45 UTSW 6 89,910,261 (GRCm39) missense possibly damaging 0.53
R8223:Vmn1r45 UTSW 6 89,910,074 (GRCm39) missense probably damaging 0.99
R8942:Vmn1r45 UTSW 6 89,910,876 (GRCm39) missense probably benign 0.00
RF019:Vmn1r45 UTSW 6 89,910,091 (GRCm39) missense probably damaging 0.99
X0026:Vmn1r45 UTSW 6 89,910,724 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATATGATGTCATCCCAGCCC -3'
(R):5'- TGACTCAGCTGAGAACAAGTG -3'

Sequencing Primer
(F):5'- CCTCCGAGAAATAAAAATATCTGTGG -3'
(R):5'- CTCAGCTGAGAACAAGTGAGAGC -3'
Posted On 2016-05-10