Incidental Mutation 'R4982:Klra2'
ID 384911
Institutional Source Beutler Lab
Gene Symbol Klra2
Ensembl Gene ENSMUSG00000030187
Gene Name killer cell lectin-like receptor, subfamily A, member 2
Synonyms Ly49b
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 131196186-131224325 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 131197152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 282 (D282E)
Ref Sequence ENSEMBL: ENSMUSP00000086252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032306] [ENSMUST00000088867]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032306
AA Change: D249E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032306
Gene: ENSMUSG00000030187
AA Change: D249E

DomainStartEndE-ValueType
CLECT 137 260 1.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088867
AA Change: D282E

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000086252
Gene: ENSMUSG00000030187
AA Change: D282E

DomainStartEndE-ValueType
CLECT 137 293 6.54e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: The gene is a member of the large lectin-like type 2 transmembrane receptor family of the natural killer gene complex. The gene is located distantly telomeric to its family's gene cluster on chromosome 6. The gene differs from the other genes in its cluster as its promoter region contains long and short interspersed repetitive elements suggesting a possible rearrangement or gene conversion. It is unknown whether this gene's encoded protein is involved with natural killer cell differentiation as are its other family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Klra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Klra2 APN 6 131,207,180 (GRCm39) missense probably benign 0.11
IGL02280:Klra2 APN 6 131,222,256 (GRCm39) missense probably damaging 1.00
IGL02503:Klra2 APN 6 131,207,057 (GRCm39) missense probably benign 0.10
IGL03120:Klra2 APN 6 131,197,180 (GRCm39) missense probably benign 0.00
FR4449:Klra2 UTSW 6 131,198,809 (GRCm39) frame shift probably null
FR4548:Klra2 UTSW 6 131,198,814 (GRCm39) frame shift probably null
FR4737:Klra2 UTSW 6 131,198,815 (GRCm39) frame shift probably null
R0082:Klra2 UTSW 6 131,197,210 (GRCm39) missense possibly damaging 0.90
R0597:Klra2 UTSW 6 131,197,148 (GRCm39) missense probably benign 0.00
R0606:Klra2 UTSW 6 131,197,187 (GRCm39) missense probably damaging 1.00
R0636:Klra2 UTSW 6 131,197,067 (GRCm39) splice site probably benign
R0800:Klra2 UTSW 6 131,207,137 (GRCm39) nonsense probably null
R1645:Klra2 UTSW 6 131,220,857 (GRCm39) critical splice donor site probably null
R1655:Klra2 UTSW 6 131,197,174 (GRCm39) missense probably damaging 0.96
R1950:Klra2 UTSW 6 131,207,078 (GRCm39) missense probably benign 0.02
R2088:Klra2 UTSW 6 131,219,789 (GRCm39) missense probably damaging 0.99
R2402:Klra2 UTSW 6 131,220,864 (GRCm39) missense probably benign 0.01
R3776:Klra2 UTSW 6 131,219,926 (GRCm39) missense probably benign 0.06
R4131:Klra2 UTSW 6 131,205,180 (GRCm39) missense probably benign 0.03
R4570:Klra2 UTSW 6 131,220,900 (GRCm39) missense probably damaging 1.00
R4585:Klra2 UTSW 6 131,207,120 (GRCm39) missense probably benign 0.11
R4586:Klra2 UTSW 6 131,207,120 (GRCm39) missense probably benign 0.11
R4884:Klra2 UTSW 6 131,207,165 (GRCm39) missense probably damaging 1.00
R5043:Klra2 UTSW 6 131,197,135 (GRCm39) missense probably benign 0.06
R5457:Klra2 UTSW 6 131,198,852 (GRCm39) missense possibly damaging 0.92
R6526:Klra2 UTSW 6 131,198,839 (GRCm39) missense probably benign 0.21
R6538:Klra2 UTSW 6 131,219,953 (GRCm39) missense probably damaging 0.99
R7393:Klra2 UTSW 6 131,207,165 (GRCm39) missense probably damaging 1.00
R7785:Klra2 UTSW 6 131,222,253 (GRCm39) missense possibly damaging 0.95
R8394:Klra2 UTSW 6 131,222,273 (GRCm39) missense possibly damaging 0.94
R8809:Klra2 UTSW 6 131,197,198 (GRCm39) missense possibly damaging 0.55
R8924:Klra2 UTSW 6 131,205,214 (GRCm39) missense probably benign 0.02
R9467:Klra2 UTSW 6 131,197,070 (GRCm39) critical splice donor site probably null
R9667:Klra2 UTSW 6 131,219,836 (GRCm39) missense probably benign 0.32
R9779:Klra2 UTSW 6 131,198,801 (GRCm39) missense unknown
RF020:Klra2 UTSW 6 131,198,801 (GRCm39) frame shift probably null
RF059:Klra2 UTSW 6 131,198,801 (GRCm39) frame shift probably null
RF064:Klra2 UTSW 6 131,198,802 (GRCm39) frame shift probably null
Z1088:Klra2 UTSW 6 131,205,253 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGATTGAGTTCTGTGAATGAATG -3'
(R):5'- AGAAGATCCCTGTGTGCCAC -3'

Sequencing Primer
(F):5'- GAATGATTCAGCTGTTAGGTAGTCAC -3'
(R):5'- AGCCATGTCATTGGTCCAAG -3'
Posted On 2016-05-10