Incidental Mutation 'R4982:Klra2'
ID384911
Institutional Source Beutler Lab
Gene Symbol Klra2
Ensembl Gene ENSMUSG00000030187
Gene Namekiller cell lectin-like receptor, subfamily A, member 2
SynonymsLy49b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4982 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location131219223-131247362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131220189 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 282 (D282E)
Ref Sequence ENSEMBL: ENSMUSP00000086252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032306] [ENSMUST00000088867]
Predicted Effect probably benign
Transcript: ENSMUST00000032306
AA Change: D249E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032306
Gene: ENSMUSG00000030187
AA Change: D249E

DomainStartEndE-ValueType
CLECT 137 260 1.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088867
AA Change: D282E

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000086252
Gene: ENSMUSG00000030187
AA Change: D282E

DomainStartEndE-ValueType
CLECT 137 293 6.54e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: The gene is a member of the large lectin-like type 2 transmembrane receptor family of the natural killer gene complex. The gene is located distantly telomeric to its family's gene cluster on chromosome 6. The gene differs from the other genes in its cluster as its promoter region contains long and short interspersed repetitive elements suggesting a possible rearrangement or gene conversion. It is unknown whether this gene's encoded protein is involved with natural killer cell differentiation as are its other family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Klra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Klra2 APN 6 131230217 missense probably benign 0.11
IGL02280:Klra2 APN 6 131245293 missense probably damaging 1.00
IGL02503:Klra2 APN 6 131230094 missense probably benign 0.10
IGL03120:Klra2 APN 6 131220217 missense probably benign 0.00
FR4449:Klra2 UTSW 6 131221846 frame shift probably null
FR4548:Klra2 UTSW 6 131221851 frame shift probably null
FR4737:Klra2 UTSW 6 131221852 frame shift probably null
R0082:Klra2 UTSW 6 131220247 missense possibly damaging 0.90
R0597:Klra2 UTSW 6 131220185 missense probably benign 0.00
R0606:Klra2 UTSW 6 131220224 missense probably damaging 1.00
R0636:Klra2 UTSW 6 131220104 splice site probably benign
R0800:Klra2 UTSW 6 131230174 nonsense probably null
R1645:Klra2 UTSW 6 131243894 critical splice donor site probably null
R1655:Klra2 UTSW 6 131220211 missense probably damaging 0.96
R1950:Klra2 UTSW 6 131230115 missense probably benign 0.02
R2088:Klra2 UTSW 6 131242826 missense probably damaging 0.99
R2402:Klra2 UTSW 6 131243901 missense probably benign 0.01
R3776:Klra2 UTSW 6 131242963 missense probably benign 0.06
R4131:Klra2 UTSW 6 131228217 missense probably benign 0.03
R4570:Klra2 UTSW 6 131243937 missense probably damaging 1.00
R4585:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4586:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4884:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R5043:Klra2 UTSW 6 131220172 missense probably benign 0.06
R5457:Klra2 UTSW 6 131221889 missense possibly damaging 0.92
R6526:Klra2 UTSW 6 131221876 missense probably benign 0.21
R6538:Klra2 UTSW 6 131242990 missense probably damaging 0.99
R7393:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R7785:Klra2 UTSW 6 131245290 missense possibly damaging 0.95
RF020:Klra2 UTSW 6 131221838 frame shift probably null
RF059:Klra2 UTSW 6 131221838 frame shift probably null
RF064:Klra2 UTSW 6 131221839 frame shift probably null
Z1088:Klra2 UTSW 6 131228290 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGATTGAGTTCTGTGAATGAATG -3'
(R):5'- AGAAGATCCCTGTGTGCCAC -3'

Sequencing Primer
(F):5'- GAATGATTCAGCTGTTAGGTAGTCAC -3'
(R):5'- AGCCATGTCATTGGTCCAAG -3'
Posted On2016-05-10