Incidental Mutation 'R4982:Vmn1r175'
ID384914
Institutional Source Beutler Lab
Gene Symbol Vmn1r175
Ensembl Gene ENSMUSG00000095632
Gene Namevomeronasal 1 receptor 175
SynonymsGm6299
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4982 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23807182-23810643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23809069 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 44 (N44K)
Ref Sequence ENSEMBL: ENSMUSP00000154170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166141] [ENSMUST00000228383]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166141
AA Change: N44K

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126357
Gene: ENSMUSG00000095632
AA Change: N44K

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 8.8e-15 PFAM
Pfam:7tm_1 13 285 2.5e-6 PFAM
Pfam:V1R 41 295 4.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228383
AA Change: N44K

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Vmn1r175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02944:Vmn1r175 APN 7 23809166 missense probably damaging 0.97
PIT4531001:Vmn1r175 UTSW 7 23809178 missense possibly damaging 0.62
R1163:Vmn1r175 UTSW 7 23808512 missense probably benign 0.30
R1901:Vmn1r175 UTSW 7 23808793 missense probably benign 0.00
R1926:Vmn1r175 UTSW 7 23809041 missense possibly damaging 0.81
R1957:Vmn1r175 UTSW 7 23808383 missense probably benign 0.21
R2163:Vmn1r175 UTSW 7 23808927 missense probably benign 0.29
R2381:Vmn1r175 UTSW 7 23808668 missense probably benign 0.31
R3109:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R3419:Vmn1r175 UTSW 7 23808650 missense probably damaging 0.96
R3941:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R5191:Vmn1r175 UTSW 7 23809022 missense possibly damaging 0.91
R5326:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5333:Vmn1r175 UTSW 7 23808579 missense possibly damaging 0.69
R5476:Vmn1r175 UTSW 7 23809131 missense possibly damaging 0.82
R5542:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5761:Vmn1r175 UTSW 7 23808480 missense probably benign 0.01
R5918:Vmn1r175 UTSW 7 23808947 missense probably damaging 1.00
R6163:Vmn1r175 UTSW 7 23809166 missense possibly damaging 0.71
R6563:Vmn1r175 UTSW 7 23808605 missense possibly damaging 0.61
R7476:Vmn1r175 UTSW 7 23808422 missense probably benign 0.01
R7616:Vmn1r175 UTSW 7 23808606 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTCGAGCCACCAGCCAAATG -3'
(R):5'- AAAGTAGAGCTGCCCTTCGTG -3'

Sequencing Primer
(F):5'- GCCAAATGAAGTACCCAAGTTTAC -3'
(R):5'- CCTTCGTGGGGGAAAATGTC -3'
Posted On2016-05-10