Incidental Mutation 'R4982:Fes'
ID384919
Institutional Source Beutler Lab
Gene Symbol Fes
Ensembl Gene ENSMUSG00000053158
Gene Namefeline sarcoma oncogene
Synonymsc-fes
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4982 (G1)
Quality Score163
Status Not validated
Chromosome7
Chromosomal Location80377756-80387946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80387204 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 44 (Y44C)
Ref Sequence ENSEMBL: ENSMUSP00000146281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000107362] [ENSMUST00000120753] [ENSMUST00000122232] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206698] [ENSMUST00000206728] [ENSMUST00000206744]
Predicted Effect probably damaging
Transcript: ENSMUST00000080932
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158
AA Change: Y44C

DomainStartEndE-ValueType
FCH 1 94 2.22e-26 SMART
coiled coil region 133 165 N/A INTRINSIC
coiled coil region 320 344 N/A INTRINSIC
SH2 458 536 8.41e-26 SMART
TyrKc 561 814 1.57e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107362
SMART Domains Protein: ENSMUSP00000102985
Gene: ENSMUSG00000030530

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120753
SMART Domains Protein: ENSMUSP00000113793
Gene: ENSMUSG00000030530

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 33 107 5.8e-28 PFAM
Pfam:Peptidase_S8 144 427 9.1e-51 PFAM
Pfam:P_proprotein 484 570 4.4e-32 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122232
SMART Domains Protein: ENSMUSP00000113370
Gene: ENSMUSG00000030530

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146771
Predicted Effect probably damaging
Transcript: ENSMUST00000205617
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206271
Predicted Effect probably damaging
Transcript: ENSMUST00000206479
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206539
Predicted Effect probably damaging
Transcript: ENSMUST00000206698
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206728
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206744
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a null allele show partial in utero lethality, runting, altered hematopoietic homeostasis and macrophage function, skin lesions and susceptibility to bacterial infection. Homozygotes for another null allele show enhanced LPS sensitivity, altered hematopoiesis and larger litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Fes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Fes APN 7 80383273 missense probably benign 0.01
IGL01654:Fes APN 7 80386810 critical splice donor site probably null
IGL02350:Fes APN 7 80383830 splice site probably null
IGL02357:Fes APN 7 80383830 splice site probably null
IGL02811:Fes APN 7 80379841 missense probably damaging 1.00
R0112:Fes UTSW 7 80384005 missense probably damaging 0.99
R0114:Fes UTSW 7 80378035 missense probably damaging 0.99
R0143:Fes UTSW 7 80383895 missense probably benign 0.00
R0786:Fes UTSW 7 80386920 missense probably damaging 1.00
R0863:Fes UTSW 7 80380886 missense probably damaging 1.00
R0918:Fes UTSW 7 80381205 missense probably damaging 1.00
R1167:Fes UTSW 7 80383109 missense probably damaging 1.00
R1174:Fes UTSW 7 80377951 missense probably damaging 1.00
R1674:Fes UTSW 7 80377938 missense probably benign 0.04
R1898:Fes UTSW 7 80379911 missense probably damaging 1.00
R1908:Fes UTSW 7 80386861 missense probably damaging 0.98
R1909:Fes UTSW 7 80386861 missense probably damaging 0.98
R1922:Fes UTSW 7 80383986 nonsense probably null
R2209:Fes UTSW 7 80380283 missense probably damaging 1.00
R2242:Fes UTSW 7 80381725 missense probably damaging 1.00
R3012:Fes UTSW 7 80387167 missense possibly damaging 0.81
R4607:Fes UTSW 7 80387211 missense probably damaging 1.00
R4608:Fes UTSW 7 80387211 missense probably damaging 1.00
R5516:Fes UTSW 7 80387183 missense probably damaging 1.00
R6120:Fes UTSW 7 80380867 missense probably damaging 1.00
R6148:Fes UTSW 7 80380296 missense probably damaging 1.00
R7161:Fes UTSW 7 80380861 missense probably damaging 0.98
R7401:Fes UTSW 7 80378776 critical splice donor site probably null
R7408:Fes UTSW 7 80378662 missense probably damaging 1.00
R7761:Fes UTSW 7 80380867 missense probably damaging 1.00
Z1177:Fes UTSW 7 80378030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGACTACAGCACATTGTGG -3'
(R):5'- TTGTCTCCACTGAATGACCCG -3'

Sequencing Primer
(F):5'- CTACAGCACATTGTGGGATAGG -3'
(R):5'- ACTGAATGACCCGGTTTCTG -3'
Posted On2016-05-10