Mutagenetix > Incidental Mutations

Incidental Mutation 'R4982:Fes'

384919

Institutional Source

Beutler Lab

Gene Symbol

Fes

Ensembl Gene

ENSMUSG00000053158

Gene Name

feline sarcoma oncogene

Synonyms

c-fes

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4982 (G1)

Quality Score

163

Status

Not validated

Chromosome

Chromosomal Location

80377756-80387946 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80387204 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 44 (Y44C)

Ref Sequence

ENSEMBL: ENSMUSP00000146281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000107362] [ENSMUST00000120753] [ENSMUST00000122232] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206698] [ENSMUST00000206728] [ENSMUST00000206744]

Predicted Effect

probably damaging
Transcript: ENSMUST00000080932
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158
AA Change: Y44C

Domain	Start	End	E-Value	Type
FCH	1	94	2.22e-26	SMART
coiled coil region	133	165	N/A	INTRINSIC
coiled coil region	320	344	N/A	INTRINSIC
SH2	458	536	8.41e-26	SMART
TyrKc	561	814	1.57e-144	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107362

SMART Domains

Protein: ENSMUSP00000102985
Gene: ENSMUSG00000030530

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
PDB:1KN6\|A	27	107	4e-7	PDB
Pfam:Peptidase_S8	148	436	3.2e-62	PFAM
Pfam:P_proprotein	484	570	1.3e-33	PFAM
FU	577	620	4.67e-5	SMART
FU	638	681	2.13e-8	SMART
transmembrane domain	713	735	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120753

SMART Domains

Protein: ENSMUSP00000113793
Gene: ENSMUSG00000030530

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:S8_pro-domain	33	107	5.8e-28	PFAM
Pfam:Peptidase_S8	144	427	9.1e-51	PFAM
Pfam:P_proprotein	484	570	4.4e-32	PFAM
FU	577	620	4.67e-5	SMART
FU	638	681	2.13e-8	SMART
transmembrane domain	713	735	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122232

SMART Domains

Protein: ENSMUSP00000113370
Gene: ENSMUSG00000030530

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
PDB:1KN6\|A	27	107	4e-7	PDB
Pfam:Peptidase_S8	148	436	3.2e-62	PFAM
Pfam:P_proprotein	484	570	1.3e-33	PFAM
FU	577	620	4.67e-5	SMART
FU	638	681	2.13e-8	SMART
transmembrane domain	713	735	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146771

Predicted Effect

probably damaging
Transcript: ENSMUST00000205617
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206271

Predicted Effect

probably damaging
Transcript: ENSMUST00000206479
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206539

Predicted Effect

probably damaging
Transcript: ENSMUST00000206698
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206728
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206744
AA Change: Y44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a null allele show partial in utero lethality, runting, altered hematopoietic homeostasis and macrophage function, skin lesions and susceptibility to bacterial infection. Homozygotes for another null allele show enhanced LPS sensitivity, altered hematopoiesis and larger litter size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,292,348	I1404L	possibly damaging	Het
Adra1b	A	G	11: 43,835,230	S287P	probably damaging	Het
Atxn2	G	T	5: 121,814,343	A1280S	possibly damaging	Het
Bbip1	T	C	19: 53,932,208		probably null	Het
Bbs2	A	G	8: 94,082,354		probably null	Het
Bcl11b	A	T	12: 107,965,772	C180*	probably null	Het
Bod1l	A	G	5: 41,820,473	V1166A	probably benign	Het
Bora	C	T	14: 99,047,352	P13S	probably damaging	Het
C2cd4c	T	C	10: 79,613,241	E24G	probably benign	Het
Ccne1	A	T	7: 38,100,571	I196N	probably damaging	Het
Chsy3	C	T	18: 59,409,575	S595L	probably benign	Het
Chsy3	T	A	18: 59,409,767	I659N	possibly damaging	Het
Cntrob	T	A	11: 69,311,362		probably null	Het
Col5a2	G	A	1: 45,389,458	P983S	possibly damaging	Het
Crat	T	A	2: 30,407,136		probably null	Het
Ctnnbl1	C	T	2: 157,836,553	H359Y	probably benign	Het
D430041D05Rik	A	G	2: 104,255,387	V83A	possibly damaging	Het
Dixdc1	A	G	9: 50,682,602	S488P	possibly damaging	Het
Dmrta1	T	C	4: 89,688,564	C86R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Fam171a1	G	A	2: 3,178,468		probably null	Het
Fam222b	T	C	11: 78,154,743	C249R	probably damaging	Het
Fbxw18	T	A	9: 109,702,651		probably benign	Het
Gimap6	A	G	6: 48,707,999	V51A	probably benign	Het
Gpr75	C	A	11: 30,891,462	H122Q	probably damaging	Het
Gpr75	C	T	11: 30,891,463	L123F	possibly damaging	Het
Greb1	A	G	12: 16,724,761	S212P	probably damaging	Het
Grin3a	T	C	4: 49,665,512	H1041R	probably benign	Het
Ifna5	A	G	4: 88,835,624	N34D	probably damaging	Het
Ift140	A	T	17: 25,036,994	H221L	probably damaging	Het
Igsf3	T	C	3: 101,435,667	V540A	probably benign	Het
Il10ra	A	G	9: 45,269,059	L5S	probably damaging	Het
Klra2	A	T	6: 131,220,189	D282E	probably benign	Het
Lyst	T	A	13: 13,725,954	H3138Q	probably damaging	Het
Malrd1	A	G	2: 16,042,129	T1689A	probably benign	Het
Mon2	A	T	10: 122,995,789	L1671M	probably damaging	Het
Mpped1	T	C	15: 83,836,327	F71S	probably damaging	Het
Mtpap	C	A	18: 4,396,332	H541Q	probably benign	Het
Muc5ac	T	A	7: 141,809,456		probably benign	Het
Mybbp1a	T	C	11: 72,445,214	I451T	probably damaging	Het
Myh7	T	A	14: 54,972,767	E1827V	probably damaging	Het
Olfr132	A	T	17: 38,130,577	I205N	probably damaging	Het
Olfr145	C	A	9: 37,897,515	T37N	probably damaging	Het
Olfr342	A	T	2: 36,527,397		probably null	Het
Olfr501-ps1	T	A	7: 108,508,648	Y197*	probably null	Het
Os9	C	T	10: 127,121,051	R23H	possibly damaging	Het
Otud6b	A	G	4: 14,815,607	L261P	probably damaging	Het
Pcdhga2	A	G	18: 37,669,423	N107D	probably benign	Het
Pclo	C	T	5: 14,679,294		probably benign	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phtf1	T	A	3: 103,998,708	S524T	probably damaging	Het
Pkdrej	A	C	15: 85,818,996	L913R	probably damaging	Het
Pld1	C	A	3: 28,031,298	A201D	probably damaging	Het
Rorb	T	A	19: 18,977,688	Q103L	probably benign	Het
Sec24d	C	T	3: 123,299,606	T284M	probably benign	Het
Serpinb3b	T	C	1: 107,157,754	I86V	probably benign	Het
Serpinb6a	A	T	13: 33,918,874	M201K	probably damaging	Het
Snx8	A	G	5: 140,352,234	S219P	probably benign	Het
Sp8	C	T	12: 118,848,425	T5I	probably damaging	Het
Tanc1	A	G	2: 59,799,943	N749D	probably damaging	Het
Tarm1	G	C	7: 3,489,096	P284A	probably damaging	Het
Tbx15	A	T	3: 99,254,074	E65V	probably benign	Het
Ticam1	T	A	17: 56,272,020	H25L	probably benign	Het
Tmprss11g	T	A	5: 86,492,815	L170F	probably damaging	Het
Tnfsf9	A	G	17: 57,107,504	*310W	probably null	Het
Tsks	C	T	7: 44,943,994	T128I	possibly damaging	Het
Uhrf1bp1	T	C	17: 27,886,606	F702S	probably benign	Het
Vmn1r175	A	T	7: 23,809,069	N44K	possibly damaging	Het
Vmn1r45	A	G	6: 89,933,865	I41T	probably damaging	Het
Ythdc2	A	G	18: 44,871,465	N1102S	probably benign	Het
Zswim4	C	T	8: 84,226,667		probably null	Het

Other mutations in Fes

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01470:Fes	APN	7	80383273	missense	probably benign	0.01
IGL01654:Fes	APN	7	80386810	critical splice donor site	probably null
IGL02350:Fes	APN	7	80383830	splice site	probably null
IGL02357:Fes	APN	7	80383830	splice site	probably null
IGL02811:Fes	APN	7	80379841	missense	probably damaging	1.00
R0112:Fes	UTSW	7	80384005	missense	probably damaging	0.99
R0114:Fes	UTSW	7	80378035	missense	probably damaging	0.99
R0143:Fes	UTSW	7	80383895	missense	probably benign	0.00
R0786:Fes	UTSW	7	80386920	missense	probably damaging	1.00
R0863:Fes	UTSW	7	80380886	missense	probably damaging	1.00
R0918:Fes	UTSW	7	80381205	missense	probably damaging	1.00
R1167:Fes	UTSW	7	80383109	missense	probably damaging	1.00
R1174:Fes	UTSW	7	80377951	missense	probably damaging	1.00
R1674:Fes	UTSW	7	80377938	missense	probably benign	0.04
R1898:Fes	UTSW	7	80379911	missense	probably damaging	1.00
R1908:Fes	UTSW	7	80386861	missense	probably damaging	0.98
R1909:Fes	UTSW	7	80386861	missense	probably damaging	0.98
R1922:Fes	UTSW	7	80383986	nonsense	probably null
R2209:Fes	UTSW	7	80380283	missense	probably damaging	1.00
R2242:Fes	UTSW	7	80381725	missense	probably damaging	1.00
R3012:Fes	UTSW	7	80387167	missense	possibly damaging	0.81
R4607:Fes	UTSW	7	80387211	missense	probably damaging	1.00
R4608:Fes	UTSW	7	80387211	missense	probably damaging	1.00
R5516:Fes	UTSW	7	80387183	missense	probably damaging	1.00
R6120:Fes	UTSW	7	80380867	missense	probably damaging	1.00
R6148:Fes	UTSW	7	80380296	missense	probably damaging	1.00
R7161:Fes	UTSW	7	80380861	missense	probably damaging	0.98
R7401:Fes	UTSW	7	80378776	critical splice donor site	probably null
R7408:Fes	UTSW	7	80378662	missense	probably damaging	1.00
R7761:Fes	UTSW	7	80380867	missense	probably damaging	1.00
Z1177:Fes	UTSW	7	80378030	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGGACTACAGCACATTGTGG -3'
(R):5'- TTGTCTCCACTGAATGACCCG -3'

Sequencing Primer
(F):5'- CTACAGCACATTGTGGGATAGG -3'
(R):5'- ACTGAATGACCCGGTTTCTG -3'

Posted On

2016-05-10