Incidental Mutation 'R4982:Muc5ac'
ID 384920
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Name mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms MGM, 2210005L13Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4982 (G1)
Quality Score 132
Status Not validated
Chromosome 7
Chromosomal Location 141788972-141819231 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to A at 141809456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041924
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155534
AA Change: I2168N
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: I2168N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163321
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 (GRCm38) I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 (GRCm38) S287P probably damaging Het
Atxn2 G T 5: 121,814,343 (GRCm38) A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 (GRCm38) probably null Het
Bbs2 A G 8: 94,082,354 (GRCm38) probably null Het
Bcl11b A T 12: 107,965,772 (GRCm38) C180* probably null Het
Bod1l A G 5: 41,820,473 (GRCm38) V1166A probably benign Het
Bora C T 14: 99,047,352 (GRCm38) P13S probably damaging Het
C2cd4c T C 10: 79,613,241 (GRCm38) E24G probably benign Het
Ccne1 A T 7: 38,100,571 (GRCm38) I196N probably damaging Het
Chsy3 T A 18: 59,409,767 (GRCm38) I659N possibly damaging Het
Chsy3 C T 18: 59,409,575 (GRCm38) S595L probably benign Het
Cntrob T A 11: 69,311,362 (GRCm38) probably null Het
Col5a2 G A 1: 45,389,458 (GRCm38) P983S possibly damaging Het
Crat T A 2: 30,407,136 (GRCm38) probably null Het
Ctnnbl1 C T 2: 157,836,553 (GRCm38) H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 (GRCm38) V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 (GRCm38) S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 (GRCm38) C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 (GRCm38) probably null Homo
Fam171a1 G A 2: 3,178,468 (GRCm38) probably null Het
Fam222b T C 11: 78,154,743 (GRCm38) C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 (GRCm38) probably benign Het
Fes T C 7: 80,387,204 (GRCm38) Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 (GRCm38) V51A probably benign Het
Gpr75 C T 11: 30,891,463 (GRCm38) L123F possibly damaging Het
Gpr75 C A 11: 30,891,462 (GRCm38) H122Q probably damaging Het
Greb1 A G 12: 16,724,761 (GRCm38) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm38) H1041R probably benign Het
Ifna5 A G 4: 88,835,624 (GRCm38) N34D probably damaging Het
Ift140 A T 17: 25,036,994 (GRCm38) H221L probably damaging Het
Igsf3 T C 3: 101,435,667 (GRCm38) V540A probably benign Het
Il10ra A G 9: 45,269,059 (GRCm38) L5S probably damaging Het
Klra2 A T 6: 131,220,189 (GRCm38) D282E probably benign Het
Lyst T A 13: 13,725,954 (GRCm38) H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 (GRCm38) T1689A probably benign Het
Mon2 A T 10: 122,995,789 (GRCm38) L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 (GRCm38) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm38) H541Q probably benign Het
Mybbp1a T C 11: 72,445,214 (GRCm38) I451T probably damaging Het
Myh7 T A 14: 54,972,767 (GRCm38) E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 (GRCm38) I205N probably damaging Het
Olfr145 C A 9: 37,897,515 (GRCm38) T37N probably damaging Het
Olfr342 A T 2: 36,527,397 (GRCm38) probably null Het
Olfr501-ps1 T A 7: 108,508,648 (GRCm38) Y197* probably null Het
Os9 C T 10: 127,121,051 (GRCm38) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm38) L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 (GRCm38) N107D probably benign Het
Pclo C T 5: 14,679,294 (GRCm38) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm38) probably benign Het
Phtf1 T A 3: 103,998,708 (GRCm38) S524T probably damaging Het
Pkdrej A C 15: 85,818,996 (GRCm38) L913R probably damaging Het
Pld1 C A 3: 28,031,298 (GRCm38) A201D probably damaging Het
Rorb T A 19: 18,977,688 (GRCm38) Q103L probably benign Het
Sec24d C T 3: 123,299,606 (GRCm38) T284M probably benign Het
Serpinb3b T C 1: 107,157,754 (GRCm38) I86V probably benign Het
Serpinb6a A T 13: 33,918,874 (GRCm38) M201K probably damaging Het
Snx8 A G 5: 140,352,234 (GRCm38) S219P probably benign Het
Sp8 C T 12: 118,848,425 (GRCm38) T5I probably damaging Het
Tanc1 A G 2: 59,799,943 (GRCm38) N749D probably damaging Het
Tarm1 G C 7: 3,489,096 (GRCm38) P284A probably damaging Het
Tbx15 A T 3: 99,254,074 (GRCm38) E65V probably benign Het
Ticam1 T A 17: 56,272,020 (GRCm38) H25L probably benign Het
Tmprss11g T A 5: 86,492,815 (GRCm38) L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 (GRCm38) *310W probably null Het
Tsks C T 7: 44,943,994 (GRCm38) T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 (GRCm38) F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 (GRCm38) N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 (GRCm38) I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 (GRCm38) N1102S probably benign Het
Zswim4 C T 8: 84,226,667 (GRCm38) probably null Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141,812,703 (GRCm38) missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141,807,473 (GRCm38) missense probably benign 0.12
IGL01155:Muc5ac APN 7 141,806,943 (GRCm38) splice site probably benign
IGL01452:Muc5ac APN 7 141,817,555 (GRCm38) missense probably benign 0.00
IGL01590:Muc5ac APN 7 141,798,893 (GRCm38) missense probably benign 0.02
IGL02104:Muc5ac APN 7 141,811,078 (GRCm38) missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141,800,177 (GRCm38) missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141,818,800 (GRCm38) nonsense probably null
IGL02178:Muc5ac APN 7 141,805,447 (GRCm38) splice site probably benign
IGL02403:Muc5ac APN 7 141,803,450 (GRCm38) missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141,817,044 (GRCm38) missense probably benign 0.01
IGL02665:Muc5ac APN 7 141,791,086 (GRCm38) missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141,795,263 (GRCm38) missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141,805,775 (GRCm38) missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141,813,781 (GRCm38) missense probably benign 0.34
IGL03384:Muc5ac APN 7 141,812,403 (GRCm38) missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141,795,213 (GRCm38) missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141,807,416 (GRCm38) missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141,818,630 (GRCm38) missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141,795,275 (GRCm38) missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141,811,039 (GRCm38) missense probably benign 0.08
R0363:Muc5ac UTSW 7 141,800,960 (GRCm38) missense probably benign 0.01
R0384:Muc5ac UTSW 7 141,812,251 (GRCm38) missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141,792,034 (GRCm38) nonsense probably null
R0583:Muc5ac UTSW 7 141,807,608 (GRCm38) missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141,796,244 (GRCm38) missense probably benign 0.02
R0682:Muc5ac UTSW 7 141,805,669 (GRCm38) missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141,807,709 (GRCm38) missense probably benign 0.03
R0883:Muc5ac UTSW 7 141,796,265 (GRCm38) missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141,807,515 (GRCm38) missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141,816,929 (GRCm38) missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141,807,323 (GRCm38) missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141,807,377 (GRCm38) missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141,813,892 (GRCm38) splice site probably null
R1599:Muc5ac UTSW 7 141,798,903 (GRCm38) missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141,801,531 (GRCm38) missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141,807,086 (GRCm38) missense probably benign 0.00
R1911:Muc5ac UTSW 7 141,796,304 (GRCm38) missense probably benign 0.18
R1922:Muc5ac UTSW 7 141,793,689 (GRCm38) missense probably benign 0.03
R1966:Muc5ac UTSW 7 141,803,376 (GRCm38) missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141,813,152 (GRCm38) missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141,792,035 (GRCm38) missense probably benign 0.01
R2126:Muc5ac UTSW 7 141,810,742 (GRCm38) missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141,812,347 (GRCm38) missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141,791,008 (GRCm38) missense probably benign 0.41
R2259:Muc5ac UTSW 7 141,791,008 (GRCm38) missense probably benign 0.41
R2293:Muc5ac UTSW 7 141,807,199 (GRCm38) missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141,818,104 (GRCm38) missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141,791,140 (GRCm38) missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141,807,641 (GRCm38) missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141,792,736 (GRCm38) splice site probably null
R3762:Muc5ac UTSW 7 141,807,475 (GRCm38) missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141,798,501 (GRCm38) missense probably benign 0.32
R3806:Muc5ac UTSW 7 141,813,734 (GRCm38) missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141,814,723 (GRCm38) missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141,791,224 (GRCm38) missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141,802,892 (GRCm38) missense probably benign
R3981:Muc5ac UTSW 7 141,813,775 (GRCm38) missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141,799,844 (GRCm38) critical splice donor site probably null
R4043:Muc5ac UTSW 7 141,807,478 (GRCm38) missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141,811,130 (GRCm38) missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141,802,835 (GRCm38) missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141,817,110 (GRCm38) missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141,791,103 (GRCm38) missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141,789,763 (GRCm38) missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141,817,601 (GRCm38) missense probably benign 0.00
R4789:Muc5ac UTSW 7 141,798,882 (GRCm38) missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141,817,902 (GRCm38) nonsense probably null
R4971:Muc5ac UTSW 7 141,816,278 (GRCm38) missense possibly damaging 0.68
R5088:Muc5ac UTSW 7 141,796,319 (GRCm38) missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141,814,742 (GRCm38) missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141,793,971 (GRCm38) missense probably benign 0.32
R5366:Muc5ac UTSW 7 141,807,550 (GRCm38) missense probably benign 0.01
R5497:Muc5ac UTSW 7 141,807,643 (GRCm38) missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141,807,832 (GRCm38) missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141,793,715 (GRCm38) critical splice donor site probably null
R5811:Muc5ac UTSW 7 141,798,984 (GRCm38) missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141,817,907 (GRCm38) missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141,790,669 (GRCm38) nonsense probably null
R5977:Muc5ac UTSW 7 141,796,367 (GRCm38) missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141,811,857 (GRCm38) missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141,801,232 (GRCm38) missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141,815,586 (GRCm38) missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141,789,795 (GRCm38) missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141,816,864 (GRCm38) nonsense probably null
R6341:Muc5ac UTSW 7 141,801,492 (GRCm38) missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141,812,679 (GRCm38) missense probably benign 0.05
R6481:Muc5ac UTSW 7 141,809,071 (GRCm38) intron probably benign
R6483:Muc5ac UTSW 7 141,802,854 (GRCm38) missense probably benign 0.18
R6627:Muc5ac UTSW 7 141,808,690 (GRCm38) intron probably benign
R6636:Muc5ac UTSW 7 141,818,605 (GRCm38) missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141,818,605 (GRCm38) missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141,803,328 (GRCm38) missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141,798,992 (GRCm38) missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141,809,552 (GRCm38) intron probably benign
R6844:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6847:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6852:Muc5ac UTSW 7 141,816,907 (GRCm38) missense probably benign 0.03
R6862:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6863:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6864:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6865:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6874:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6875:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6876:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6877:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6889:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R6920:Muc5ac UTSW 7 141,793,298 (GRCm38) missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141,818,714 (GRCm38) missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141,809,687 (GRCm38) intron probably benign
R7091:Muc5ac UTSW 7 141,809,687 (GRCm38) intron probably benign
R7092:Muc5ac UTSW 7 141,809,687 (GRCm38) intron probably benign
R7092:Muc5ac UTSW 7 141,809,648 (GRCm38) intron probably benign
R7110:Muc5ac UTSW 7 141,799,822 (GRCm38) missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141,813,822 (GRCm38) nonsense probably null
R7238:Muc5ac UTSW 7 141,809,687 (GRCm38) intron probably benign
R7238:Muc5ac UTSW 7 141,809,517 (GRCm38) missense unknown
R7396:Muc5ac UTSW 7 141,808,415 (GRCm38) missense unknown
R7456:Muc5ac UTSW 7 141,793,167 (GRCm38) missense probably benign 0.32
R7477:Muc5ac UTSW 7 141,816,282 (GRCm38) missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141,813,799 (GRCm38) missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141,808,668 (GRCm38) missense unknown
R7604:Muc5ac UTSW 7 141,809,709 (GRCm38) missense unknown
R7635:Muc5ac UTSW 7 141,805,676 (GRCm38) missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141,805,753 (GRCm38) missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141,809,422 (GRCm38) missense unknown
R7651:Muc5ac UTSW 7 141,796,254 (GRCm38) missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141,809,383 (GRCm38) missense unknown
R7720:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7749:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7750:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7751:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7754:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7798:Muc5ac UTSW 7 141,794,041 (GRCm38) critical splice donor site probably null
R7835:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7837:Muc5ac UTSW 7 141,815,963 (GRCm38) missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141,803,429 (GRCm38) missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141,795,852 (GRCm38) missense probably benign 0.00
R7874:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7876:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7877:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7881:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7884:Muc5ac UTSW 7 141,809,303 (GRCm38) missense unknown
R7921:Muc5ac UTSW 7 141,809,687 (GRCm38) intron probably benign
R7976:Muc5ac UTSW 7 141,809,791 (GRCm38) missense unknown
R8104:Muc5ac UTSW 7 141,804,783 (GRCm38) missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141,807,331 (GRCm38) missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141,802,948 (GRCm38) missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141,809,263 (GRCm38) missense unknown
R8386:Muc5ac UTSW 7 141,807,634 (GRCm38) missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141,810,476 (GRCm38) missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141,807,155 (GRCm38) missense probably damaging 1.00
R8709:Muc5ac UTSW 7 141,816,926 (GRCm38) missense possibly damaging 0.96
R8725:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R8727:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
R8754:Muc5ac UTSW 7 141,800,271 (GRCm38) missense possibly damaging 0.85
R8769:Muc5ac UTSW 7 141,818,872 (GRCm38) missense probably damaging 1.00
R8933:Muc5ac UTSW 7 141,789,756 (GRCm38) missense possibly damaging 0.59
R8939:Muc5ac UTSW 7 141,793,354 (GRCm38) missense probably damaging 0.98
R9049:Muc5ac UTSW 7 141,808,975 (GRCm38) missense unknown
R9124:Muc5ac UTSW 7 141,809,792 (GRCm38) missense unknown
R9131:Muc5ac UTSW 7 141,809,792 (GRCm38) missense unknown
R9132:Muc5ac UTSW 7 141,809,792 (GRCm38) missense unknown
R9135:Muc5ac UTSW 7 141,798,481 (GRCm38) missense probably damaging 0.99
R9156:Muc5ac UTSW 7 141,809,792 (GRCm38) missense unknown
R9157:Muc5ac UTSW 7 141,809,792 (GRCm38) missense unknown
R9159:Muc5ac UTSW 7 141,809,792 (GRCm38) missense unknown
R9160:Muc5ac UTSW 7 141,809,792 (GRCm38) missense unknown
R9161:Muc5ac UTSW 7 141,799,289 (GRCm38) missense possibly damaging 0.53
R9175:Muc5ac UTSW 7 141,812,356 (GRCm38) missense possibly damaging 0.92
R9183:Muc5ac UTSW 7 141,798,900 (GRCm38) missense possibly damaging 0.71
R9218:Muc5ac UTSW 7 141,807,361 (GRCm38) missense probably damaging 0.99
R9219:Muc5ac UTSW 7 141,817,063 (GRCm38) nonsense probably null
R9239:Muc5ac UTSW 7 141,800,217 (GRCm38) missense probably damaging 0.99
R9246:Muc5ac UTSW 7 141,810,478 (GRCm38) missense probably benign 0.11
R9287:Muc5ac UTSW 7 141,807,889 (GRCm38) missense probably damaging 0.99
R9320:Muc5ac UTSW 7 141,815,518 (GRCm38) missense probably benign 0.01
R9327:Muc5ac UTSW 7 141,811,692 (GRCm38) missense possibly damaging 0.86
R9428:Muc5ac UTSW 7 141,808,822 (GRCm38) missense unknown
R9430:Muc5ac UTSW 7 141,808,832 (GRCm38) missense unknown
R9454:Muc5ac UTSW 7 141,808,694 (GRCm38) missense unknown
R9483:Muc5ac UTSW 7 141,811,728 (GRCm38) nonsense probably null
R9581:Muc5ac UTSW 7 141,810,062 (GRCm38) missense unknown
R9610:Muc5ac UTSW 7 141,796,341 (GRCm38) missense possibly damaging 0.86
R9642:Muc5ac UTSW 7 141,795,864 (GRCm38) missense possibly damaging 0.71
R9684:Muc5ac UTSW 7 141,811,061 (GRCm38) missense probably benign 0.41
R9760:Muc5ac UTSW 7 141,807,248 (GRCm38) missense probably benign 0.05
R9778:Muc5ac UTSW 7 141,795,284 (GRCm38) nonsense probably null
X0060:Muc5ac UTSW 7 141,803,333 (GRCm38) missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141,811,692 (GRCm38) missense possibly damaging 0.86
Z1088:Muc5ac UTSW 7 141,809,744 (GRCm38) intron probably benign
Z1177:Muc5ac UTSW 7 141,818,040 (GRCm38) missense probably benign 0.33
Z1177:Muc5ac UTSW 7 141,809,224 (GRCm38) missense unknown
Predicted Primers PCR Primer
(F):5'- ACCCAATACAGGAAAGGGCA -3'
(R):5'- GGTGCTGCCCTTTCCTGTA -3'

Sequencing Primer
(F):5'- CAATACAGGAAAGGGCAGCACC -3'
(R):5'- CCCTTTCCTGTATTGGGTGAGC -3'
Posted On 2016-05-10