Incidental Mutation 'R4982:Zswim4'
ID384921
Institutional Source Beutler Lab
Gene Symbol Zswim4
Ensembl Gene ENSMUSG00000035671
Gene Namezinc finger SWIM-type containing 4
SynonymsE130119J17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R4982 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84210678-84237055 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 84226667 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039480]
Predicted Effect probably null
Transcript: ENSMUST00000039480
SMART Domains Protein: ENSMUSP00000040078
Gene: ENSMUSG00000035671

DomainStartEndE-ValueType
low complexity region 531 545 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Other mutations in Zswim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Zswim4 APN 8 84212140 missense probably damaging 1.00
IGL03048:Zswim4 UTSW 8 84211975 missense possibly damaging 0.95
R0217:Zswim4 UTSW 8 84212664 missense probably damaging 1.00
R0688:Zswim4 UTSW 8 84228888 missense possibly damaging 0.93
R1217:Zswim4 UTSW 8 84219972 missense possibly damaging 0.89
R1853:Zswim4 UTSW 8 84224200 missense probably damaging 1.00
R1878:Zswim4 UTSW 8 84212776 missense possibly damaging 0.55
R2205:Zswim4 UTSW 8 84225869 missense possibly damaging 0.70
R2940:Zswim4 UTSW 8 84223748 missense probably damaging 1.00
R3747:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R3748:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R3750:Zswim4 UTSW 8 84212047 missense possibly damaging 0.86
R4777:Zswim4 UTSW 8 84236957 missense probably benign
R4831:Zswim4 UTSW 8 84212319 missense probably damaging 1.00
R4959:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4968:Zswim4 UTSW 8 84217372 missense probably benign 0.37
R4973:Zswim4 UTSW 8 84212223 missense probably benign 0.22
R4977:Zswim4 UTSW 8 84226667 splice site probably null
R4978:Zswim4 UTSW 8 84226667 splice site probably null
R4980:Zswim4 UTSW 8 84226667 splice site probably null
R4981:Zswim4 UTSW 8 84226667 splice site probably null
R4983:Zswim4 UTSW 8 84226667 splice site probably null
R5248:Zswim4 UTSW 8 84219932 missense probably benign 0.13
R5337:Zswim4 UTSW 8 84235079 missense probably damaging 1.00
R5366:Zswim4 UTSW 8 84212790 missense probably benign 0.39
R5646:Zswim4 UTSW 8 84231110 splice site probably null
R5845:Zswim4 UTSW 8 84217242 splice site probably null
R6193:Zswim4 UTSW 8 84226145 missense probably benign
R6270:Zswim4 UTSW 8 84230951 missense probably damaging 1.00
R6648:Zswim4 UTSW 8 84230914 missense probably benign 0.22
R6920:Zswim4 UTSW 8 84214085 missense probably benign 0.01
R7117:Zswim4 UTSW 8 84214052 missense probably damaging 1.00
R7155:Zswim4 UTSW 8 84219927 missense probably damaging 1.00
R7344:Zswim4 UTSW 8 84223698 nonsense probably null
R7354:Zswim4 UTSW 8 84228849 missense probably damaging 1.00
R8036:Zswim4 UTSW 8 84223289 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CACTGATCCTTTGCTATCGGG -3'
(R):5'- TGGATAGGACACATGCCCAG -3'

Sequencing Primer
(F):5'- ATCCTTTGCTATCGGGAGGCC -3'
(R):5'- CTGCTTATCAGCCTGTGTTAATG -3'
Posted On2016-05-10