Incidental Mutation 'R4982:Bbs2'
ID384922
Institutional Source Beutler Lab
Gene Symbol Bbs2
Ensembl Gene ENSMUSG00000031755
Gene NameBardet-Biedl syndrome 2 (human)
Synonyms2410125H22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R4982 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94067954-94098928 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 94082354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034206]
Predicted Effect probably null
Transcript: ENSMUST00000034206
SMART Domains Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755

DomainStartEndE-ValueType
Pfam:BBS2_N 20 161 1.4e-62 PFAM
Pfam:BBS2_Mid 162 272 6.9e-50 PFAM
Pfam:BBS2_C 276 715 2.6e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172347
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene forms a multiprotein BBSome complex with seven other BBS proteins.[provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice display obesity associated with polyphagia, retinopathy associated with mislocalization of rhodopsin, cilia defects, renal cysts, male sterility, abnormal brain neuroanatomy, reduced salivation and acoustic startle response, an olfactory deficit and abnormal social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Bbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Bbs2 APN 8 94089167 critical splice acceptor site probably null
IGL02250:Bbs2 APN 8 94092426 missense probably benign 0.22
IGL02427:Bbs2 APN 8 94081118 missense possibly damaging 0.92
IGL02810:Bbs2 APN 8 94086911 missense probably benign 0.00
IGL02850:Bbs2 APN 8 94077082 missense probably benign
IGL03050:Bbs2 APN 8 94074413 splice site probably benign
IGL03292:Bbs2 APN 8 94075121 critical splice donor site probably null
rolie UTSW 8 94082364 missense probably damaging 0.96
R0755:Bbs2 UTSW 8 94082080 missense probably benign 0.22
R0835:Bbs2 UTSW 8 94075259 missense probably damaging 1.00
R1404:Bbs2 UTSW 8 94081999 missense probably null 0.01
R1404:Bbs2 UTSW 8 94081999 missense probably null 0.01
R1513:Bbs2 UTSW 8 94089844 missense possibly damaging 0.94
R1972:Bbs2 UTSW 8 94081177 splice site probably benign
R4648:Bbs2 UTSW 8 94080879 missense probably damaging 1.00
R4876:Bbs2 UTSW 8 94070160 unclassified probably benign
R4911:Bbs2 UTSW 8 94089115 missense probably damaging 1.00
R4966:Bbs2 UTSW 8 94080807 missense probably damaging 1.00
R5202:Bbs2 UTSW 8 94092414 nonsense probably null
R5347:Bbs2 UTSW 8 94092550 missense probably damaging 0.98
R5364:Bbs2 UTSW 8 94074395 missense probably benign 0.00
R5538:Bbs2 UTSW 8 94089763 missense probably damaging 1.00
R5685:Bbs2 UTSW 8 94087433 missense probably damaging 1.00
R5918:Bbs2 UTSW 8 94098303 missense probably damaging 0.98
R5963:Bbs2 UTSW 8 94081031 missense probably benign 0.02
R5964:Bbs2 UTSW 8 94068367 missense probably benign 0.18
R5991:Bbs2 UTSW 8 94098286 missense probably benign 0.24
R6050:Bbs2 UTSW 8 94092532 missense probably damaging 1.00
R6172:Bbs2 UTSW 8 94087411 missense probably benign 0.02
R6241:Bbs2 UTSW 8 94098235 critical splice donor site probably null
R6578:Bbs2 UTSW 8 94077041 missense probably null 0.00
R7330:Bbs2 UTSW 8 94087405 missense possibly damaging 0.78
R7404:Bbs2 UTSW 8 94082364 missense probably damaging 0.96
R7775:Bbs2 UTSW 8 94089760 critical splice donor site probably null
R7778:Bbs2 UTSW 8 94089760 critical splice donor site probably null
R7824:Bbs2 UTSW 8 94089760 critical splice donor site probably null
R7895:Bbs2 UTSW 8 94081136 missense probably damaging 1.00
R7978:Bbs2 UTSW 8 94081136 missense probably damaging 1.00
R8004:Bbs2 UTSW 8 94082490 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCATCTCAGCTGTGCCTGG -3'
(R):5'- AAGTGACTTTTATGCTGTGCC -3'

Sequencing Primer
(F):5'- AGCATAGCTAGCCACTTCTACTTCAG -3'
(R):5'- CTTCATTTTTAGGTTGATGCTCGCAG -3'
Posted On2016-05-10