Incidental Mutation 'R4982:Dixdc1'
ID 384925
Institutional Source Beutler Lab
Gene Symbol Dixdc1
Ensembl Gene ENSMUSG00000032064
Gene Name DIX domain containing 1
Synonyms Ccd1, 4930563F16Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 50574052-50650817 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50593902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 488 (S488P)
Ref Sequence ENSEMBL: ENSMUSP00000112431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034566] [ENSMUST00000117646] [ENSMUST00000120622] [ENSMUST00000121634]
AlphaFold Q80Y83
Predicted Effect possibly damaging
Transcript: ENSMUST00000034566
AA Change: S514P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034566
Gene: ENSMUSG00000032064
AA Change: S514P

DomainStartEndE-ValueType
CH 22 151 5.48e-8 SMART
low complexity region 178 190 N/A INTRINSIC
low complexity region 237 254 N/A INTRINSIC
coiled coil region 306 338 N/A INTRINSIC
coiled coil region 359 492 N/A INTRINSIC
Pfam:DIX 627 706 1.1e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117646
AA Change: S488P

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112431
Gene: ENSMUSG00000032064
AA Change: S488P

DomainStartEndE-ValueType
CH 22 125 1.25e-11 SMART
low complexity region 152 164 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
coiled coil region 280 312 N/A INTRINSIC
coiled coil region 333 466 N/A INTRINSIC
Pfam:DIX 600 682 5.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119449
Predicted Effect possibly damaging
Transcript: ENSMUST00000120622
AA Change: S242P

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113934
Gene: ENSMUSG00000032064
AA Change: S242P

DomainStartEndE-ValueType
coiled coil region 34 66 N/A INTRINSIC
coiled coil region 87 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121634
AA Change: S513P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113089
Gene: ENSMUSG00000032064
AA Change: S513P

DomainStartEndE-ValueType
CH 21 150 5.48e-8 SMART
low complexity region 177 189 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
coiled coil region 305 337 N/A INTRINSIC
coiled coil region 358 491 N/A INTRINSIC
Pfam:DIX 625 707 5.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141919
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a positive regulator of the Wnt signaling pathway. The encoded protein is found associated with gamma tubulin at the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced spontaneous locomotor activity, abnormal behavior in the elevated plus maze, and deficits in startle reactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Dixdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dixdc1 APN 9 50,579,033 (GRCm39) missense probably damaging 0.98
IGL01556:Dixdc1 APN 9 50,617,434 (GRCm39) missense probably damaging 1.00
IGL01923:Dixdc1 APN 9 50,606,803 (GRCm39) missense possibly damaging 0.87
IGL01933:Dixdc1 APN 9 50,614,558 (GRCm39) nonsense probably null
IGL02074:Dixdc1 APN 9 50,613,317 (GRCm39) missense probably benign 0.00
IGL02364:Dixdc1 APN 9 50,593,931 (GRCm39) splice site probably benign
R0230:Dixdc1 UTSW 9 50,606,807 (GRCm39) missense possibly damaging 0.80
R0401:Dixdc1 UTSW 9 50,604,974 (GRCm39) missense possibly damaging 0.54
R0410:Dixdc1 UTSW 9 50,596,153 (GRCm39) missense probably damaging 1.00
R1028:Dixdc1 UTSW 9 50,614,546 (GRCm39) missense probably benign 0.02
R1083:Dixdc1 UTSW 9 50,588,293 (GRCm39) intron probably benign
R1672:Dixdc1 UTSW 9 50,601,164 (GRCm39) missense probably damaging 1.00
R1752:Dixdc1 UTSW 9 50,593,850 (GRCm39) missense probably benign
R2213:Dixdc1 UTSW 9 50,613,245 (GRCm39) missense probably benign 0.01
R2289:Dixdc1 UTSW 9 50,595,172 (GRCm39) critical splice donor site probably null
R2939:Dixdc1 UTSW 9 50,622,259 (GRCm39) missense probably damaging 0.98
R2940:Dixdc1 UTSW 9 50,622,259 (GRCm39) missense probably damaging 0.98
R3081:Dixdc1 UTSW 9 50,622,259 (GRCm39) missense probably damaging 0.98
R5250:Dixdc1 UTSW 9 50,595,035 (GRCm39) missense possibly damaging 0.88
R5581:Dixdc1 UTSW 9 50,580,780 (GRCm39) missense probably damaging 1.00
R5914:Dixdc1 UTSW 9 50,609,888 (GRCm39) intron probably benign
R6228:Dixdc1 UTSW 9 50,614,656 (GRCm39) splice site probably null
R6346:Dixdc1 UTSW 9 50,595,253 (GRCm39) missense probably damaging 1.00
R6370:Dixdc1 UTSW 9 50,593,523 (GRCm39) splice site probably null
R7036:Dixdc1 UTSW 9 50,593,864 (GRCm39) missense probably benign 0.03
R7074:Dixdc1 UTSW 9 50,601,214 (GRCm39) missense possibly damaging 0.83
R7361:Dixdc1 UTSW 9 50,599,953 (GRCm39) missense probably damaging 0.99
R7734:Dixdc1 UTSW 9 50,613,268 (GRCm39) missense probably damaging 1.00
R8292:Dixdc1 UTSW 9 50,621,989 (GRCm39) missense probably benign 0.03
R8318:Dixdc1 UTSW 9 50,595,709 (GRCm39) critical splice acceptor site probably null
R8353:Dixdc1 UTSW 9 50,596,186 (GRCm39) missense probably benign 0.24
R8453:Dixdc1 UTSW 9 50,596,186 (GRCm39) missense probably benign 0.24
R8462:Dixdc1 UTSW 9 50,622,079 (GRCm39) nonsense probably null
R8810:Dixdc1 UTSW 9 50,613,265 (GRCm39) missense probably damaging 1.00
R8871:Dixdc1 UTSW 9 50,595,096 (GRCm39) missense possibly damaging 0.89
R8872:Dixdc1 UTSW 9 50,614,453 (GRCm39) missense possibly damaging 0.77
RF016:Dixdc1 UTSW 9 50,604,941 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGTATAGTCAAAGGCTGGG -3'
(R):5'- CTCCAGGTCACTGTAGTGTG -3'

Sequencing Primer
(F):5'- GGCTGGGAATATTTAAAGCTTAGC -3'
(R):5'- ACGTGGATTCTCAGAGTCAGACTC -3'
Posted On 2016-05-10