Incidental Mutation 'R4982:Mon2'
ID 384928
Institutional Source Beutler Lab
Gene Symbol Mon2
Ensembl Gene ENSMUSG00000034602
Gene Name MON2 homolog, regulator of endosome to Golgi trafficking
Synonyms 2610528O22Rik, SF21
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 122827965-122912410 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122831694 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 1671 (L1671M)
Ref Sequence ENSEMBL: ENSMUSP00000131052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037557] [ENSMUST00000073792] [ENSMUST00000170935]
AlphaFold Q80TL7
Predicted Effect probably damaging
Transcript: ENSMUST00000037557
AA Change: L1670M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602
AA Change: L1670M

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073792
AA Change: L1677M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602
AA Change: L1677M

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170935
AA Change: L1671M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602
AA Change: L1671M

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222536
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Mon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mon2 APN 10 122,862,204 (GRCm39) missense probably damaging 1.00
IGL01072:Mon2 APN 10 122,846,444 (GRCm39) nonsense probably null
IGL02080:Mon2 APN 10 122,888,095 (GRCm39) missense probably damaging 0.98
IGL02157:Mon2 APN 10 122,849,377 (GRCm39) missense probably damaging 1.00
IGL02419:Mon2 APN 10 122,852,352 (GRCm39) missense probably benign 0.05
IGL02498:Mon2 APN 10 122,870,235 (GRCm39) missense probably benign 0.00
IGL02638:Mon2 APN 10 122,859,844 (GRCm39) missense probably damaging 1.00
IGL02664:Mon2 APN 10 122,845,401 (GRCm39) splice site probably benign
IGL02690:Mon2 APN 10 122,845,532 (GRCm39) missense possibly damaging 0.67
IGL02878:Mon2 APN 10 122,842,896 (GRCm39) missense probably benign 0.09
IGL03092:Mon2 APN 10 122,854,005 (GRCm39) missense probably damaging 1.00
IGL03103:Mon2 APN 10 122,866,008 (GRCm39) splice site probably benign
IGL03208:Mon2 APN 10 122,853,974 (GRCm39) splice site probably benign
R0010:Mon2 UTSW 10 122,868,599 (GRCm39) missense probably damaging 1.00
R0016:Mon2 UTSW 10 122,871,451 (GRCm39) missense probably damaging 0.96
R0016:Mon2 UTSW 10 122,871,451 (GRCm39) missense probably damaging 0.96
R0027:Mon2 UTSW 10 122,871,953 (GRCm39) missense possibly damaging 0.66
R0027:Mon2 UTSW 10 122,871,953 (GRCm39) missense possibly damaging 0.66
R0145:Mon2 UTSW 10 122,849,417 (GRCm39) missense possibly damaging 0.94
R0390:Mon2 UTSW 10 122,842,926 (GRCm39) missense probably null 0.05
R0481:Mon2 UTSW 10 122,849,301 (GRCm39) missense possibly damaging 0.94
R0513:Mon2 UTSW 10 122,874,515 (GRCm39) missense probably damaging 1.00
R0599:Mon2 UTSW 10 122,861,970 (GRCm39) splice site probably benign
R1226:Mon2 UTSW 10 122,838,724 (GRCm39) missense probably benign 0.17
R1548:Mon2 UTSW 10 122,871,912 (GRCm39) splice site probably benign
R1598:Mon2 UTSW 10 122,852,301 (GRCm39) missense probably damaging 1.00
R1650:Mon2 UTSW 10 122,831,682 (GRCm39) missense probably benign 0.45
R1687:Mon2 UTSW 10 122,862,029 (GRCm39) missense probably damaging 0.98
R1721:Mon2 UTSW 10 122,867,002 (GRCm39) missense probably damaging 0.98
R1768:Mon2 UTSW 10 122,849,668 (GRCm39) missense probably benign 0.00
R1827:Mon2 UTSW 10 122,882,216 (GRCm39) missense probably damaging 0.97
R1879:Mon2 UTSW 10 122,838,790 (GRCm39) missense probably damaging 1.00
R1954:Mon2 UTSW 10 122,874,388 (GRCm39) missense probably damaging 1.00
R1955:Mon2 UTSW 10 122,874,388 (GRCm39) missense probably damaging 1.00
R1968:Mon2 UTSW 10 122,845,470 (GRCm39) missense probably damaging 1.00
R2060:Mon2 UTSW 10 122,831,681 (GRCm39) missense probably damaging 1.00
R2160:Mon2 UTSW 10 122,911,834 (GRCm39) nonsense probably null
R2165:Mon2 UTSW 10 122,878,269 (GRCm39) splice site probably null
R3737:Mon2 UTSW 10 122,849,280 (GRCm39) missense probably damaging 1.00
R3814:Mon2 UTSW 10 122,849,470 (GRCm39) missense probably damaging 0.98
R4058:Mon2 UTSW 10 122,838,724 (GRCm39) missense probably benign 0.17
R4091:Mon2 UTSW 10 122,874,415 (GRCm39) missense probably damaging 1.00
R4214:Mon2 UTSW 10 122,852,397 (GRCm39) missense probably benign 0.03
R4354:Mon2 UTSW 10 122,862,888 (GRCm39) missense probably benign 0.02
R4422:Mon2 UTSW 10 122,878,887 (GRCm39) missense probably damaging 1.00
R4505:Mon2 UTSW 10 122,845,494 (GRCm39) missense probably damaging 0.99
R4791:Mon2 UTSW 10 122,841,962 (GRCm39) missense probably benign 0.01
R4797:Mon2 UTSW 10 122,852,422 (GRCm39) missense probably benign 0.45
R4944:Mon2 UTSW 10 122,874,364 (GRCm39) critical splice donor site probably null
R5298:Mon2 UTSW 10 122,846,511 (GRCm39) missense probably benign
R5503:Mon2 UTSW 10 122,868,550 (GRCm39) missense possibly damaging 0.54
R5653:Mon2 UTSW 10 122,861,999 (GRCm39) missense probably damaging 0.96
R5687:Mon2 UTSW 10 122,844,144 (GRCm39) missense probably damaging 0.99
R5838:Mon2 UTSW 10 122,846,397 (GRCm39) critical splice donor site probably null
R6108:Mon2 UTSW 10 122,868,600 (GRCm39) missense probably benign 0.00
R6182:Mon2 UTSW 10 122,874,564 (GRCm39) splice site probably null
R6355:Mon2 UTSW 10 122,858,825 (GRCm39) missense possibly damaging 0.58
R6358:Mon2 UTSW 10 122,849,409 (GRCm39) missense probably damaging 0.98
R6548:Mon2 UTSW 10 122,871,998 (GRCm39) missense probably damaging 1.00
R6557:Mon2 UTSW 10 122,852,307 (GRCm39) missense probably damaging 1.00
R6649:Mon2 UTSW 10 122,874,385 (GRCm39) missense possibly damaging 0.46
R7140:Mon2 UTSW 10 122,871,358 (GRCm39) missense probably benign 0.00
R7303:Mon2 UTSW 10 122,874,364 (GRCm39) critical splice donor site probably null
R7317:Mon2 UTSW 10 122,849,851 (GRCm39) missense probably damaging 0.97
R7355:Mon2 UTSW 10 122,845,421 (GRCm39) missense probably benign
R7508:Mon2 UTSW 10 122,859,844 (GRCm39) missense probably damaging 1.00
R7509:Mon2 UTSW 10 122,868,457 (GRCm39) missense probably benign
R7647:Mon2 UTSW 10 122,841,931 (GRCm39) missense probably benign
R7720:Mon2 UTSW 10 122,868,493 (GRCm39) missense probably benign 0.00
R7799:Mon2 UTSW 10 122,878,236 (GRCm39) missense probably benign 0.41
R7801:Mon2 UTSW 10 122,895,091 (GRCm39) critical splice donor site probably null
R7823:Mon2 UTSW 10 122,868,559 (GRCm39) missense probably damaging 1.00
R7985:Mon2 UTSW 10 122,852,213 (GRCm39) missense probably damaging 1.00
R8310:Mon2 UTSW 10 122,838,688 (GRCm39) missense probably damaging 1.00
R8810:Mon2 UTSW 10 122,845,516 (GRCm39) missense possibly damaging 0.94
R8825:Mon2 UTSW 10 122,849,776 (GRCm39) missense probably benign 0.00
R8937:Mon2 UTSW 10 122,895,110 (GRCm39) missense probably benign
R8978:Mon2 UTSW 10 122,871,469 (GRCm39) nonsense probably null
R9011:Mon2 UTSW 10 122,862,213 (GRCm39) missense possibly damaging 0.95
R9213:Mon2 UTSW 10 122,872,016 (GRCm39) nonsense probably null
R9358:Mon2 UTSW 10 122,868,452 (GRCm39) missense probably benign 0.00
R9630:Mon2 UTSW 10 122,874,415 (GRCm39) missense probably damaging 1.00
X0022:Mon2 UTSW 10 122,842,007 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCTACAAGACTCCGGGGAAG -3'
(R):5'- CTTGCAAAGTTCGTTGGTCTC -3'

Sequencing Primer
(F):5'- AAGGCGTTCCTCAGGGTATCTC -3'
(R):5'- GATTCCCCTGAGGCTGAAATTAG -3'
Posted On 2016-05-10