Incidental Mutation 'R0374:Apbb1ip'
ID 38493
Institutional Source Beutler Lab
Gene Symbol Apbb1ip
Ensembl Gene ENSMUSG00000026786
Gene Name amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Synonyms 9930118P07Rik, Prp48, proline-rich protein 48
MMRRC Submission 038580-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0374 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 22774094-22875653 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 22819705 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014290]
AlphaFold Q8R5A3
PDB Structure Crystal structure of the Ras-associating and pleckstrin-homology domains of RIAM [X-RAY DIFFRACTION]
Crystal structure of RIAM RA-PH domains in complex with GTP bound Rap1 [X-RAY DIFFRACTION]
Crystal structure of RIAM TBS1 in complex with talin R7R8 domains [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000014290
SMART Domains Protein: ENSMUSP00000014290
Gene: ENSMUSG00000026786

DomainStartEndE-ValueType
PDB:3ZDL|B 1 31 1e-11 PDB
low complexity region 32 39 N/A INTRINSIC
coiled coil region 62 88 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
RA 179 266 1.15e-22 SMART
low complexity region 280 299 N/A INTRINSIC
PH 314 424 2.05e-10 SMART
low complexity region 516 532 N/A INTRINSIC
low complexity region 553 570 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 622 636 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148315
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy with no apparent defects in platelet integrin activation and function, hemostasis, or arterial thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,248,961 C178S probably damaging Het
Ano9 A G 7: 141,107,814 I267T probably damaging Het
Anxa6 T A 11: 55,005,828 N168I probably benign Het
Aqr G A 2: 114,130,611 H723Y probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Car13 A G 3: 14,656,297 probably benign Het
Casp9 T A 4: 141,807,173 I298N possibly damaging Het
Ccdc66 T C 14: 27,498,473 E261G probably damaging Het
Cep192 T A 18: 67,818,883 Y376* probably null Het
Cped1 T A 6: 22,222,546 probably benign Het
Ctbp2 A T 7: 132,999,344 S563R possibly damaging Het
Ctdp1 A G 18: 80,447,422 probably null Het
Dgka G C 10: 128,721,083 probably benign Het
Drd2 A G 9: 49,399,784 T112A probably benign Het
Dusp1 A G 17: 26,508,169 V52A probably damaging Het
Eea1 T A 10: 96,039,772 probably benign Het
Etfrf1 T C 6: 145,215,562 V86A probably benign Het
Fbn1 A T 2: 125,321,676 C2087S possibly damaging Het
Fosb T G 7: 19,307,150 R139S probably damaging Het
Foxm1 C T 6: 128,372,603 R362W probably damaging Het
Frem2 A G 3: 53,653,960 V1042A probably damaging Het
Gbe1 A G 16: 70,483,914 H401R probably benign Het
Gm10549 C T 18: 33,464,182 probably benign Het
Golga7b A T 19: 42,263,319 probably benign Het
H2-DMb1 T C 17: 34,159,425 V235A probably benign Het
Hr A G 14: 70,556,476 T59A probably benign Het
Itpr2 C A 6: 146,359,392 A588S probably benign Het
Kmt2c G A 5: 25,309,708 P3046S probably damaging Het
Lamc1 G A 1: 153,251,065 probably benign Het
Lrp2 A G 2: 69,430,307 Y4527H probably damaging Het
Map3k2 G A 18: 32,212,173 probably null Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Nfs1 C G 2: 156,132,660 G212R probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nrap T A 19: 56,351,622 Y740F probably damaging Het
Nup205 T A 6: 35,208,837 M859K probably damaging Het
Nxf1 T C 19: 8,767,739 F451S possibly damaging Het
Olfr262 A T 19: 12,241,141 N173K probably damaging Het
Olfr804 G A 10: 129,705,647 M256I probably benign Het
Pcdhac2 T C 18: 37,145,667 Y567H probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pi4ka A G 16: 17,282,932 probably benign Het
Pmpcb A G 5: 21,748,831 D359G probably damaging Het
Poll T G 19: 45,557,870 S244R probably benign Het
Prkd3 T C 17: 78,957,215 D657G probably null Het
Prune2 G A 19: 17,120,910 M1259I probably benign Het
Ptpra T A 2: 130,537,621 M329K probably damaging Het
Rbm10 GGGAGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG GGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG X: 20,637,559 probably benign Het
Rbm15 G T 3: 107,330,564 D839E probably damaging Het
Sap30bp T A 11: 115,964,277 I271N probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setdb1 A T 3: 95,324,853 probably benign Het
Sgk3 T A 1: 9,879,081 probably null Het
Shox2 A T 3: 66,973,851 H265Q probably damaging Het
Slc9a2 T C 1: 40,743,857 F427S possibly damaging Het
Smarca5 T A 8: 80,736,731 Q69H probably benign Het
Specc1l T A 10: 75,248,459 F672Y probably damaging Het
Ssh2 T A 11: 77,408,143 S105R probably damaging Het
Syne2 C T 12: 75,921,226 R917* probably null Het
Tbc1d2 G A 4: 46,649,913 T41M possibly damaging Het
Tbx18 T A 9: 87,724,355 I246F probably damaging Het
Tcf4 T A 18: 69,681,812 probably benign Het
Tmed2 C A 5: 124,541,439 probably null Het
Tmem243 A T 5: 9,101,361 D15V possibly damaging Het
Vmn2r87 T A 10: 130,471,979 S797C probably damaging Het
Vps13c T A 9: 67,886,246 probably benign Het
Wls T A 3: 159,897,437 C162* probably null Het
Zbtb7c C T 18: 76,137,393 T184I probably benign Het
Zc3h13 A G 14: 75,308,965 K169E probably damaging Het
Other mutations in Apbb1ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Apbb1ip APN 2 22858280 missense possibly damaging 0.59
IGL01447:Apbb1ip APN 2 22853182 missense probably damaging 1.00
IGL02987:Apbb1ip APN 2 22867637 nonsense probably null
IGL03329:Apbb1ip APN 2 22867717 missense possibly damaging 0.92
intelligence UTSW 2 22835931 missense probably damaging 1.00
psyops UTSW 2 22853120 nonsense probably null
Simulacrum UTSW 2 22866993 critical splice donor site probably null
Tangles UTSW 2 22823598 critical splice donor site probably null
R0842:Apbb1ip UTSW 2 22867666 missense possibly damaging 0.85
R1678:Apbb1ip UTSW 2 22874880 splice site probably null
R3855:Apbb1ip UTSW 2 22875175 missense unknown
R3971:Apbb1ip UTSW 2 22823494 missense unknown
R4335:Apbb1ip UTSW 2 22871562 critical splice donor site probably null
R4569:Apbb1ip UTSW 2 22849544 missense probably damaging 1.00
R4742:Apbb1ip UTSW 2 22826916 missense unknown
R4804:Apbb1ip UTSW 2 22823598 critical splice donor site probably null
R4820:Apbb1ip UTSW 2 22875253 missense unknown
R4854:Apbb1ip UTSW 2 22853202 missense possibly damaging 0.94
R4899:Apbb1ip UTSW 2 22823349 missense unknown
R4920:Apbb1ip UTSW 2 22819684 missense unknown
R5283:Apbb1ip UTSW 2 22867671 missense probably benign 0.16
R5445:Apbb1ip UTSW 2 22835948 missense possibly damaging 0.90
R6346:Apbb1ip UTSW 2 22866993 critical splice donor site probably null
R6495:Apbb1ip UTSW 2 22853120 nonsense probably null
R6542:Apbb1ip UTSW 2 22874960 missense probably benign 0.04
R6550:Apbb1ip UTSW 2 22858233 missense probably damaging 1.00
R7011:Apbb1ip UTSW 2 22835931 missense probably damaging 1.00
R7304:Apbb1ip UTSW 2 22853135 splice site probably null
R7554:Apbb1ip UTSW 2 22823546 missense unknown
R7690:Apbb1ip UTSW 2 22816984 missense unknown
R7723:Apbb1ip UTSW 2 22871562 critical splice donor site probably null
R7831:Apbb1ip UTSW 2 22866921 missense probably damaging 1.00
R7861:Apbb1ip UTSW 2 22816978 missense unknown
R8270:Apbb1ip UTSW 2 22874992 missense unknown
R8523:Apbb1ip UTSW 2 22819636 missense unknown
R9158:Apbb1ip UTSW 2 22874939 missense probably benign 0.01
R9696:Apbb1ip UTSW 2 22835977 missense probably benign 0.11
X0014:Apbb1ip UTSW 2 22823554 small deletion probably benign
Z1177:Apbb1ip UTSW 2 22875103 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTTCACCAAGTCAGCAAAGTTTCTC -3'
(R):5'- GGAAGCGGGTCTTCTCTTTCATCATAG -3'

Sequencing Primer
(F):5'- CTCGTTATTTTCGAGTAGCACAG -3'
(R):5'- GTCCAGGGTTTACACACTGT -3'
Posted On 2013-05-23